Morpholino
MO1-aplnrb
- ID
- ZDB-MRPHLNO-070522-4
- Name
- MO1-aplnrb
- Previous Names
-
- MO1-agtrl1b
- Target
- Sequence
-
5' - CAGAGAAGTTGTTTGTCATGTGCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-aplnrb
No data available
Phenotype
Phenotype resulting from MO1-aplnrb
1 - 5 of 19 Show all
Phenotype of all Fish created by or utilizing MO1-aplnrb
1 - 5 of 39 Show all
Citations
- Stock, J., Kazmar, T., Schlumm, F., Hannezo, E., Pauli, A. (2022) A self-generated Toddler gradient guides mesodermal cell migration. Science advances. 8:eadd2488
- Helker, C.S., Eberlein, J., Wilhelm, K., Sugino, T., Malchow, J., Schuermann, A., Baumeister, S., Kwon, H.B., Maischein, H.M., Potente, M., Herzog, W., Stainier, D.Y. (2020) Apelin signaling drives vascular endothelial cells towards a pro-angiogenic state. eLIFE. 9:e55589
- Zhu, C., Guo, Z., Zhang, Y., Liu, M., Chen, B., Cao, K., Wu, Y., Yang, M., Yin, W., Zhao, H., Tai, H., Ou, Y., Yu, X., Liu, C., Li, S., Su, B., Feng, Y., Huang, S. (2019) Aplnra/b Sequentially Regulate Organ Left-Right Patterning via Distinct Mechanisms. International journal of biological sciences. 15:1225-1239
- Liu, Z., Woo, S., Weiner, O.D. (2018) Nodal signaling has dual roles in fate specification and directed migration during germ layer segregation. Development (Cambridge, England). 145(17):
- Helker, C.S., Schuermann, A., Pollmann, C., Chng, S.C., Kiefer, F., Reversade, B., Herzog, W. (2015) The hormonal peptide Elabela guides angioblasts to the midline during vasculogenesis. eLIFE. 4
- Pauli, A., Norris, M.L., Valen, E., Chew, G.L., Gagnon, J.A., Zimmerman, S., Mitchell, A., Ma, J., Dubrulle, J., Reyon, D., Tsai, S.Q., Joung, J.K., Saghatelian, A., and Schier, A.F. (2014) Toddler: an embryonic signal that promotes cell movement via Apelin receptors. Science (New York, N.Y.). 343(6172):1248636
- Chng, S.C., Ho, L., Tian, J., and Reversade, B. (2013) ELABELA: A Hormone Essential for Heart Development Signals via the Apelin Receptor. Developmental Cell. 27(6):672-680
- Zeng, X.X., Wilm, T.P., Sepich, D.S., and Solnica-Krezel, L. (2007) Apelin and Its Receptor Control Heart Field Formation during Zebrafish Gastrulation. Developmental Cell. 12(3):391-402
1 - 8 of 8
Show