Morpholino
MO1-rap1b
- ID
- ZDB-MRPHLNO-070519-2
- Name
- MO1-rap1b
- Previous Names
-
- rap1b ATG MO (1)
- Target
- Sequence
-
5' - ACGCATTGTGCAGTGTGTCCGTTAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rap1b
No data available
Phenotype
Phenotype resulting from MO1-rap1b
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO1-rap1b
1 - 5 of 36 Show all
Citations
- Bögershausen, N., Tsai, I.C., Pohl, E., Kiper, P.Ö., Beleggia, F., Percin, E.F., Keupp, K., Matchan, A., Milz, E., Alanay, Y., Kayserili, H., Liu, Y., Banka, S., Kranz, A., Zenker, M., Wieczorek, D., Elcioglu, N., Prontera, P., Lyonnet, S., Meitinger, T., Stewart, A.F., Donnai, D., Strom, T.M., Boduroglu, K., Yigit, G., Li, Y., Katsanis, N., Wollnik, B. (2015) RAP1-mediated MEK/ERK pathway defects in Kabuki syndrome. The Journal of Clinical Investigation. 125(9):3585-99
- Lackner, S., Schwendinger-Schreck, J., Jülich, D., and Holley, S.A. (2013) Segmental assembly of fibronectin matrix requires rap1b and integrin alpha5. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(2):122-131
- Dong, W., Yang, Z., Yang, F., Wang, J., Zhuang, Y., Xu, C., Zhang, B., Tian, X.L., and Liu, D. (2012) Suppression of rap1 impairs cardiac myofibrils and conduction system in zebrafish. PLoS One. 7(11):e50960
- Tsai, I.C., Amack, J.D., Gao, Z.H., Band, V., Yost, H.J., and Virshup, D.M. (2007) A Wnt-CKIε-Rap1 Pathway Regulates Gastrulation by Modulating SIPA1L1, a Rap GTPase Activating Protein. Developmental Cell. 12(3):335-347
1 - 4 of 4
Show