Morpholino
MO2-atoh1a
- ID
- ZDB-MRPHLNO-070507-2
- Name
- MO2-atoh1a
- Previous Names
-
- atoh1a MO1 (1)
- Target
- Sequence
-
5' - TCTGTTGGTTTGTGCTTTTGGGAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atoh1a
No data available
Phenotype
Phenotype resulting from MO2-atoh1a
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-atoh1a
1 - 2 of 2
Citations
- Go, W., and Korzh, V. (2013) Plasma membrane Ca(2+) ATPase Atp2b1a regulates bone mineralization in zebrafish. Bone. 54(1):48-57
- Villegas, R., Martin, S.M., O'Donnell, K., Carrillo, S., Sagasti, A., and Allende, M.L. (2012) Dynamics of degeneration and regeneration in developing zebrafish peripheral axons reveals a requirement for extrinsic cell types. Neural Development. 7(1):19
- Millimaki, B.B., Sweet, E.M., Dhason, M.S., and Riley, B.B. (2007) Zebrafish atoh1 genes: classic proneural activity in the inner ear and regulation by Fgf and Notch. Development (Cambridge, England). 134(2):295-305
- Sarrazin, A.F., Villablanca, E.J., Nunez, V.A., Sandoval, P.C., Ghysen, A., and Allende, M.L. (2006) Proneural gene requirement for hair cell differentiation in the zebrafish lateral line. Developmental Biology. 295(2):534-545
1 - 4 of 4
Show