Morpholino

MO5-dlx4b

ID
ZDB-MRPHLNO-070504-3
Name
MO5-dlx4b
Previous Names
  • dlx7-2 (1)
Target
Sequence
5' - TCAGACATGAAACTCATAGACATCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-dlx4b
Phenotype
Phenotype resulting from MO5-dlx4b
No data available
Phenotype of all Fish created by or utilizing MO5-dlx4b
Phenotype Fish Conditions Figures
otic vesicle development process quality, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otolith absent, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode formation arrested, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 5 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode formation arrested, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 5 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
otic vesicle development process quality, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
post-vent region wholly ventralized, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
inner ear lacks all parts of type otolith, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 9 with image from Esterberg et al., 2009
otolith absent, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
intermediate cell mass of mesoderm increased size, abnormal WT + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
inner ear lacks all parts of type otolith, abnormal WT + MO1-bmper + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 9 with image from Esterberg et al., 2009
intermediate cell mass of mesoderm increased size, abnormal WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
post-vent region wholly ventralized, abnormal WT + MO1-chrd + MO5-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Esterberg et al., 2009
Citations