Morpholino
MO2-sox9a
- ID
- ZDB-MRPHLNO-070412-1
- Name
- MO2-sox9a
- Previous Names
- Target
- Sequence
-
5' - AATGAATTACTCACCTCCAAAGTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox9a
No data available
Phenotype
Phenotype resulting from MO2-sox9a
No data available
Phenotype of all Fish created by or utilizing MO2-sox9a
1 - 5 of 25 Show all
Citations
- Chen, J.W., Galloway, J.L. (2014) The development of zebrafish tendon and ligament progenitors. Development (Cambridge, England). 141:2035-45
- Le Pabic, P., Ng, C., Schilling, T.F. (2014) Fat-Dachsous Signaling Coordinates Cartilage Differentiation and Polarity during Craniofacial Development. PLoS Genetics. 10:e1004726
- Hofsteen, P., Plavicki, J., Johnson, S.D., Peterson, R.E., and Heideman, W. (2013) Sox9b is Required for Epicardium Formation and Plays a Role in TCDD-induced Heart Malformation in Zebrafish. Molecular pharmacology. 84(3):353-60
- Lien, H.W., Yang, C.H., Cheng, C.H., Liao, Y.F., Han, Y.S., and Huang, C.J. (2013) Zinc finger protein 219-like (ZNF219L) and Sox9a regulate synuclein-gamma2 (sncgb) expression in the developing notochord of zebrafish. Biochemical and Biophysical Research Communications. 442(3-4):189-194
- Koskinen, J., Karlsson, J., and Olsson, P.E. (2009) Sox9a regulation of ff1a in zebrafish (Danio rerio) suggests an involvement of ff1a in cartilage development. Comparative biochemistry and physiology. Part A, Molecular & integrative physiology. 153(1):39-43
- Yan, Y.-L., Miller, C.T., Nissen, R.M., Singer, A., Liu, D., Kirn, A., Draper, B., Willoughby, J., Morcos, P.A., Amsterdam, A., Chung, B.-C., Westerfield, M., Haffter, P., Hopkins, N., Kimmel, C., and Postlethwait, J.H. (2002) A zebrafish sox9 gene required for cartilage morphogenesis. Development (Cambridge, England). 129(21):5065-5079
1 - 6 of 6
Show