Morpholino
MO1-rpl5a
- ID
- ZDB-MRPHLNO-070327-5
- Name
- MO1-rpl5a
- Previous Names
- Target
- Sequence
-
5' - ACCCATTTTGTGATCGTTTGTTCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpl5a
No data available
Phenotype
Phenotype resulting from MO1-rpl5a
1 - 5 of 34 Show all
Phenotype of all Fish created by or utilizing MO1-rpl5a
1 - 5 of 54 Show all
Citations
- Flentke, G.R., Wilkie, T.E., Baulch, J., Huang, Y., Smith, S.M. (2024) Alcohol exposure suppresses ribosome biogenesis and causes nucleolar stress in cranial neural crest cells. PLoS One. 19:e0304557e0304557
- Berres, M.E., Garic, A., Flentke, G.R., Smith, S.M. (2017) Transcriptome Profiling Identifies Ribosome Biogenesis as a Target of Alcohol Teratogenicity and Vulnerability during Early Embryogenesis. PLoS One. 12:e0169351
- Wan, Y., Zhang, Q., Zhang, Z., Song, B., Wang, X., Zhang, Y., Jia, Q., Cheng, T., Zhu, X., Leung, A.Y., Yuan, W., Jia, H., Fang, X. (2016) Transcriptome analysis reveals a ribosome constituents disorder involved in the RPL5 downregulated zebrafish model of Diamond-Blackfan anemia. BMC Medical Genomics. 9:13
- Chakraborty, A., Uechi, T., Higa, S., Torihara, H., and Kenmochi, N. (2009) Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response. PLoS One. 4(1):e4152
- Uechi, T., Nakajima, Y., Nakao, A., Torihara, H., Chakraborty, A., Inoue, K., and Kenmochi, N. (2006) Ribosomal protein gene knockdown causes developmental defects in zebrafish. PLoS One. 1(1):e37
1 - 5 of 5
Show