Morpholino
MO1-rpl36a
- ID
- ZDB-MRPHLNO-070327-12
- Name
- MO1-rpl36a
- Previous Names
- None
- Target
- Sequence
-
5' - CATGGTTGCCCTCGCGGCGCAGGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rpl36a
No data available
Phenotype
Phenotype resulting from MO1-rpl36a
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-rpl36a
1 - 5 of 10 Show all
Citations
- Torihara, H., Uechi, T., Chakraborty, A., Shinya, M., Sakai, N., and Kenmochi, N. (2011) Erythropoiesis failure due to RPS19 deficiency is independent of an activated Tp53 response in a zebrafish model of Diamond-Blackfan anaemia. British journal of haematology. 152(5):648-654
- Uechi, T., Nakajima, Y., Chakraborty, A., Torihara, H., Higa, S., and Kenmochi, N. (2008) Deficiency of ribosomal protein S19 during early embryogenesis leads to reduction of erythrocytes in a zebrafish model of Diamond-Blackfan anemia. Human molecular genetics. 17(20):3204-3211
- Uechi, T., Nakajima, Y., Nakao, A., Torihara, H., Chakraborty, A., Inoue, K., and Kenmochi, N. (2006) Ribosomal protein gene knockdown causes developmental defects in zebrafish. PLoS One. 1(1):e37
1 - 3 of 3
Show