Morpholino
MO2-tcf7l2
- ID
- ZDB-MRPHLNO-070209-2
- Name
- MO2-tcf7l2
- Previous Names
-
- MO2-tcf4
- Target
- Sequence
-
5' - AGCTGCGGCATTTTTCCCGAGGAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tcf7l2
No data available
Phenotype
Phenotype resulting from MO2-tcf7l2
Phenotype | Fish | Figures |
---|---|---|
post-vent region morphology, abnormal | WT + MO2-tcf7l2 |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-tcf7l2
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
post-vent region morphology, abnormal | WT + MO2-tcf7l2 | standard conditions |
Fig. 5 ![]() |
1 - 1 of 1
Citations
- Lu, F.I., Sun, Y.H., Wei, C.Y., Thisse, C., Thisse, B. (2014) Tissue-specific derepression of TCF/LEF controls the activity of the Wnt/β-catenin pathway. Nature communications. 5:5368
- Ota, S., Ishitani, S., Shimizu, N., Matsumoto, K., Itoh, M., and Ishitani, T. (2012) NLK positively regulates Wnt/beta-catenin signalling by phosphorylating LEF1 in neural progenitor cells. The EMBO journal. 31(8):1904-1915
- Shimizu, N., Kawakami, K., and Ishitani, T. (2012) Visualization and exploration of Tcf/Lef function using a highly responsive Wnt/beta-catenin signaling-reporter transgenic zebrafish. Developmental Biology. 370(1):71-85
- Meier, N., Krpic, S., Rodriguez, P., Strouboulis, J., Monti, M., Krijgsveld, J., Gering, M., Patient, R., Hostert, A., and Grosveld, F. (2006) Novel binding partners of Ldb1 are required for haematopoietic development. Development (Cambridge, England). 133(24):4913-4923
1 - 4 of 4
Show