Morpholino
MO1-snai1a
- ID
- ZDB-MRPHLNO-061206-3
- Name
- MO1-snai1a
- Previous Names
- None
- Target
- Sequence
-
5' - ATCAGTCCACTCCAGTTACTTTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-snai1a
No data available
Phenotype
Phenotype resulting from MO1-snai1a
No data available
Phenotype of all Fish created by or utilizing MO1-snai1a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| heart looping disrupted, abnormal | WT + MO1-snai1a + MO1-tdp2b | standard conditions |
text only
from Esguerra et al., 2007 |
1 - 1 of 1
Citations
- Esguerra, C.V., Nelles, L., Vermeire, L., Ibrahimi, A., Crawford, A.D., Derua, R., Janssens, E., Waelkens, E., Carmeliet, P., Collen, D., and Huylebroeck, D. (2007) Ttrap is an essential modulator of Smad3-dependent Nodal signaling during zebrafish gastrulation and left-right axis determination. Development (Cambridge, England). 134(24):4381-4393
- Arnaud, E., Ferri, K.F., Thibaut, J., Haftek-Terreau, Z., Aouacheria, A., Le Guellec, D., Lorca, T., and Gillet, G. (2006) The zebrafish bcl-2 homologue Nrz controls development during somitogenesis and gastrulation via apoptosis-dependent and -independent mechanisms. Cell death and differentiation. 13(7):1128-1137
1 - 2 of 2
Show