Morpholino
MO2-igf1ra
- ID
- ZDB-MRPHLNO-061130-4
- Name
- MO2-igf1ra
- Previous Names
- None
- Target
- Sequence
-
5' - TGAAATTGCAGAAAAACGCGAGGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-igf1ra
No data available
Phenotype
Phenotype resulting from MO2-igf1ra
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO2-igf1ra
1 - 5 of 34 Show all
Citations
- Chen, S., Liu, Y., Rong, X., Li, Y., Zhou, J., Lu, L. (2017) Neuroprotective Role of the PI3 Kinase/Akt Signaling Pathway in Zebrafish. Frontiers in endocrinology. 8:21
- Schlueter, P.J., Peng, G., Westerfield, M., and Duan, C. (2007) Insulin-like growth factor signaling regulates zebrafish embryonic growth and development by promoting cell survival and cell cycle progression. Cell death and differentiation. 14(6):1095-1105
- Schlueter, P.J., Sang, X., Duan, C., and Wood, A.W. (2007) Insulin-like growth factor receptor 1b is required for zebrafish primordial germ cell migration and survival. Developmental Biology. 305(1):377-387
- Schlueter, P.J., Royer, T., Farah, M.H., Laser, B., Chan, S.J., Steiner, D.F., and Duan, C. (2006) Gene duplication and functional divergence of the zebrafish insulin-like growth factor 1 receptors. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 20(8):1230-1232
1 - 4 of 4
Show