Morpholino
MO3-runx2b
- ID
- ZDB-MRPHLNO-061127-3
- Name
- MO3-runx2b
- Previous Names
-
- runx2bT2MO1 (1)
- Target
- Sequence
-
5' - CATGGTCGCCACTTTCGCTCCCAAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-runx2b
No data available
Phenotype
Phenotype resulting from MO3-runx2b
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO3-runx2b
1 - 4 of 4
Citations
- Suarez-Bregua, P., Torres-Nuñez, E., Saxena, A., Guerreiro, P., Braasch, I., Prober, D.A., Moran, P., Cerda-Reverter, J.M., Du, S.J., Adrio, F., Power, D.M., Canario, A.V., Postlethwait, J.H., Bronner, M.E., Cañestro, C., Rotllant, J. (2017) Pth4, an ancient parathyroid hormone lost in eutherian mammals, reveals a new brain-to-bone signaling pathway. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 31:569-583
- Yang, D.C., Tsai, C.C., Liao, Y.F., Fu, H.C., Tsay, H.J., Huang, T.F., Chen, Y.H., and Hung, S.C. (2011) Twist controls skeletal development and dorsoventral patterning by regulating runx2 in zebrafish. PLoS One. 6(11):e27324
- Flores, M.V., Lam, E.Y., Crosier, K.E., and Crosier, P.S. (2008) Osteogenic transcription factor Runx2 is a maternal determinant of dorsoventral patterning in zebrafish. Nature cell biology. 10(3):346-352
- Flores, M.V., Lam, E.Y., Crosier, P., and Crosier, K. (2006) A hierarchy of Runx transcription factors modulate the onset of chondrogenesis in craniofacial endochondral bones in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 235(11):3166-3176
1 - 4 of 4
Show