Morpholino
MO1-foxc1a
- ID
- ZDB-MRPHLNO-061111-1
- Name
- MO1-foxc1a
- Previous Names
- None
- Target
- Sequence
-
5' - GTCAAGAAGACTGAAGCAATCCACA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxc1a
No data available
Phenotype
Phenotype resulting from MO1-foxc1a
Phenotype | Fish | Figures |
---|---|---|
pronephric podocyte decreased amount, abnormal | TU + MO1-foxc1a |
Fig. 3 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-foxc1a
1 - 5 of 13 Show all
Citations
- Lupo, G., Gestri, G., O'Brien, M., Denton, R.M., Chandraratna, R.A., Ley, S.V., Harris, W.A., and Wilson, S.W. (2011) Retinoic acid receptor signaling regulates choroid fissure closure through independent mechanisms in the ventral optic cup and periocular mesenchyme. Proceedings of the National Academy of Sciences of the United States of America. 108(21):8698-8703
- O'Brien, L.L., Grimaldi, M., Kostun, Z., Wingert, R.A., Selleck, R., and Davidson, A.J. (2011) Wt1a, Foxc1a, and the Notch mediator Rbpj physically interact and regulate the formation of podocytes in zebrafish. Developmental Biology. 358(2):318-30
- Palencia-Desai, S., Kohli, V., Kang, J., Chi, N.C., Black, B.L., and Sumanas, S. (2011) Vascular endothelial and endocardial progenitors differentiate as cardiomyocytes in the absence of Etsrp/Etv2 function. Development (Cambridge, England). 138(21):4721-4732
- Lee, H.C., Tseng, W.A., Lo, F.Y., Liu, T.M., and Tsai, H.J. (2009) FoxD5 mediates anterior-posterior polarity through upstream modulator Fgf signaling during zebrafish somitogenesis. Developmental Biology. 336(2):232-245
- Skarie, J.M., and Link, B.A. (2009) FoxC1 is essential for vascular basement membrane integrity and hyaloid vessel morphogenesis. Investigative ophthalmology & visual science. 50(11):5026-5034
- Berry, F.B., Skarie, J.M., Mirzayans, F., Fortin, Y., Hudson, T.J., Raymond, V., Link, B.A., and Walter, M.A. (2008) FOXC1 is required for cell viability and resistance to oxidative stress in the eye through the transcriptional regulation of FOXO1A. Human molecular genetics. 17(4):490-505
- Topczewska, J.M., Topczewski, J., Shostak, A., Kume, T., Solnica-Krezel, L., and Hogan, B.L. (2001) The winged helix transcription factor Foxc1a is essential for somitogenesis in zebrafish. Genes & Development. 15(18):2483-2493
1 - 7 of 7
Show