Morpholino
MO1-atp6v0ca
- ID
- ZDB-MRPHLNO-060927-6
- Name
- MO1-atp6v0ca
- Previous Names
-
- MO1-atp6v0c
- SP1990 A (1)
- Target
- Sequence
-
5' - GTTCGGGAGACTAAAACTAAAGGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp6v0ca
No data available
Phenotype
Phenotype resulting from MO1-atp6v0ca
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-atp6v0ca
1 - 5 of 7 Show all
Citations
- Sasaki, T., Lian, S., Khan, A., Llop, J.R., Samuelson, A.V., Chen, W., Klionsky, D.J., Kishi, S. (2017) Autolysosome biogenesis and developmental senescence are regulated by both Spns1 and v-ATPase. Autophagy. 13(2):386-403
- Pickart, M.A., Klee, E.W., Nielsen, A.L., Sivasubbu, S., Mendenhall, E.M., Bill B.R., Chen, E., Eckfeldt, C.E., Knowlton, M., Robu, M.E., Larson, J.D., Deng, Y., Schimmenti, L.A., Ellis, L.B., Verfaillie, C.M., Hammerschmidt, M., Farber, S.A., and Ekker, S.C. (2006) Genome-wide reverse genetics framework to identify novel functions of the vertebrate secretome. PLoS One. 1(1):e104
- Pickart, M.A., Sivasubbu, S., Nielsen, A.L., Shriram, S., King, R.A., and Ekker, S.C. (2004) Functional genomics tools for the analysis of zebrafish pigment. Pigment cell research. 17(5):461-470
1 - 3 of 3
Show