Morpholino
MO3-tfap2a
- ID
- ZDB-MRPHLNO-060927-3
- Name
- MO3-tfap2a
- Previous Names
-
- tfap2a1 5.1mo (1)
- Target
- Sequence
-
5' - CCTCCATTCTTAGATTTGGCCCTAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targeted to intron 5 splice acceptor junction
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tfap2a
No data available
Phenotype
Phenotype resulting from MO3-tfap2a
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO3-tfap2a
1 - 5 of 18 Show all
Citations
- Damm, E.W., Clements, W.K. (2017) Pdgf signalling guides neural crest contribution to the haematopoietic stem cell specification niche. Nature cell biology. 19(5):457-467
- Ando, K., Fukuhara, S., Izumi, N., Nakajima, H., Fukui, H., Kelsh, R.N., Mochizuki, N. (2016) Clarification of mural cell coverage of vascular endothelial cells by live imaging of zebrafish. Development (Cambridge, England). 143(8):1328-39
- Whitesell, T.R., Kennedy, R.M., Carter, A.D., Rollins, E.L., Georgijevic, S., Santoro, M.M., Childs, S.J. (2014) An alpha-smooth muscle actin (acta2/alphasma) zebrafish transgenic line marking vascular mural cells and visceral smooth muscle cells. PLoS One. 9:e90590
- Powell, D.R., Hernandez-Lagunas, L., Lamonica, K., and Artinger, K.B. (2013) Prdm1a directly activates foxd3 and tfap2a during zebrafish neural crest specification. Development (Cambridge, England). 140(16):3445-3455
- Knight, R.D., Mebus, K., d'Angelo, A., Yokoya, K., Heanue, T., and Roehl, H. (2011) Ret signalling integrates a craniofacial muscle module during development. Development (Cambridge, England). 138(10):2015-2024
- Wang, W.D., Melville, D.B., Montero-Balaguer, M., Hatzopoulos, A.K., and Knapik, E.W. (2011) Tfap2a and Foxd3 regulate early steps in the development of the neural crest progenitor population. Developmental Biology. 360(1):173-85
- Zhou, Y., Cashman, T.J., Nevis, K.R., Obregon, P., Carney, S.A., Liu, Y., Gu, A., Mosimann, C., Sondalle, S., Peterson, R.E., Heideman, W., Burns, C.E., and Burns, C.G. (2011) Latent TGF-β binding protein 3 identifies a second heart field in zebrafish. Nature. 474(7353):645-8
- Kastenhuber, E., Kratochwil, C.F., Ryu, S., Schweitzer, J., and Driever, W. (2010) Genetic dissection of dopaminergic and noradrenergic contributions to catecholaminergic tracts in early larval zebrafish. The Journal of comparative neurology. 518(4):439-458
- Kastenhuber, E., Kern U., Bonkowsky, J.L., Chien, C.B., Driever, W., and Schweitzer, J. (2009) Netrin-DCC, Robo-Slit, and heparan sulfate proteoglycans coordinate lateral positioning of longitudinal dopaminergic diencephalospinal axons. The Journal of neuroscience : the official journal of the Society for Neuroscience. 29(28):8914-8926
- Hoffman, T.L., Javier, A.L., Campeau, S.A., Knight, R.D., and Schilling, T.F. (2007) Tfap2 transcription factors in zebrafish neural crest development and ectodermal evolution. Journal of experimental zoology. Part B, Molecular and developmental evolution. 308(5):679-691
1 - 10 of 11
Show