Morpholino
MO2-ezrb
- ID
- ZDB-MRPHLNO-060919-3
- Name
- MO2-ezrb
- Previous Names
-
- MO2-ezr
- MO2-vil2 (1)
- Target
- Sequence
-
5' - GATGTAGATGCCGATTCCTCTCGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ezrb
No data available
Phenotype
Phenotype resulting from MO2-ezrb
1 - 5 of 25 Show all
Phenotype of all Fish created by or utilizing MO2-ezrb
1 - 5 of 27 Show all
Citations
- Prince, D.J., Jessen, J.R. (2019) Dorsal convergence of gastrula cells requires a Vangl2 and adhesion protein-dependent change in protrusive activity. Development (Cambridge, England). 146(22):
- Sidhaye, J., Norden, C. (2017) Concerted action of neuroepithelial basal shrinkage and active epithelial migration ensures efficient optic cup morphogenesis. eLIFE. 6
- Xu, W., Jin, M., Hu, R., Wang, H., Zhang, F., Yuan, S., Cao, Y. (2017) The Joubert Syndrome Protein Inpp5e Controls Ciliogenesis by Regulating Phosphoinositides at the Apical Membrane. Journal of the American Society of Nephrology : JASN. 28(1):118-129
- Diz-Muñoz, A., Romanczuk, P., Yu, W., Bergert, M., Ivanovitch, K., Salbreux, G., Heisenberg, C.P., Paluch, E.K. (2016) Steering cell migration by alternating blebs and actin-rich protrusions. BMC Biology. 14:74
- Epting, D., Slanchev, K., Boehlke, C., Hoff, S., Loges, N.T., Yasunaga, T., Indorf, L., Nestel, S., Lienkamp, S.S., Omran, H., Kuehn, E.W., Ronneberger, O., Walz, G., Kramer-Zucker, A. (2015) The Rac1 regulator ELMO controls basal body migration and docking in multiciliated cells through interaction with Ezrin. Development (Cambridge, England). 142:174-84
- Diz-Munoz, A., Krieg, M., Bergert, M., Ibarlucea-Benitez, I., Muller, D.J., Paluch, E., and Heisenberg, C.P. (2010) Control of Directed Cell Migration In Vivo by Membrane-to-Cortex Attachment. PLoS Biology. 8(11):e1000544
- Link, V., Carvalho, L., Castanon, I., Stockinger, P., Shevchenko, A., and Heisenberg, C.P. (2006) Identification of regulators of germ layer morphogenesis using proteomics in zebrafish. Journal of Cell Science. 119(10):2073-2083
1 - 7 of 7
Show