Morpholino

MO2-ezrb

ID
ZDB-MRPHLNO-060919-3
Name
MO2-ezrb
Previous Names
  • MO2-ezr
  • MO2-vil2 (1)
Target
Sequence
5' - GATGTAGATGCCGATTCCTCTCGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ezrb
No data available
Phenotype
Phenotype resulting from MO2-ezrb
Phenotype Fish Figures
anterior axial hypoblast decreased cellular motility, abnormal WT + MO2-ezrb Fig. 3 with image from Diz-Munoz et al., 2010
anterior axial hypoblast bleb increased amount, abnormal WT + MO2-ezrb Fig. 2 with image from Diz-Munoz et al., 2010
anterior axial hypoblast bleb increased size, abnormal WT + MO2-ezrb Fig. 2 with image from Diz-Munoz et al., 2010
anterior axial hypoblast filopodium decreased amount, abnormal WT + MO2-ezrb Fig. 2 with image from Diz-Munoz et al., 2010
anterior axial hypoblast lamellipodium decreased amount, abnormal WT + MO2-ezrb Fig. 2 with image from Diz-Munoz et al., 2010
brain hydrocephalic, abnormal AB/TL + MO2-ezrb Fig. 3 with image from Epting et al., 2015
cell migration involved in mesendoderm migration decreased process quality, abnormal WT + MO2-ezrb Fig. 3 with image from Diz-Munoz et al., 2010
cytoskeleton organization decreased process quality, abnormal WT + MO2-ezrb Fig. 2 with image from Diz-Munoz et al., 2010
post-vent region curved ventral, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
prechordal plate formation decreased process quality, abnormal WT + MO2-ezrb Fig. 3 with image from Diz-Munoz et al., 2010
pronephric duct has fewer parts of type pronephric duct motile cilium, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate mislocalised, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate mislocalised, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct actin filament bundle distribution decreased process quality, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct apical plasma membrane ab1-atp1a1 labeling mislocalised, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct ciliary basal body mislocalised, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct cilium assembly decreased occurrence, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct filamentous actin mislocalised, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric duct obsolete ciliary basal body-plasma membrane docking decreased process quality, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
pronephric glomerulus cystic, abnormal TU + MO2-ezrb Fig. 2Fig. 3 from Xu et al., 2017
pronephric tubule has fewer parts of type pronephric tubule microvillus, abnormal AB/TL + MO2-ezrb Fig. 3 with image from Epting et al., 2015
pronephros cystic, abnormal AB/TL + MO2-ezrb Fig. 3 with image from Epting et al., 2015
pronephros cilium assembly decreased process quality, abnormal AB/TL + MO2-ezrb Fig. 3 with image from Epting et al., 2015
pronephros morphogenesis decreased process quality, abnormal TU + MO2-ezrb Fig. 2 from Xu et al., 2017
regulation of cell projection assembly process quality, abnormal WT + MO2-ezrb Fig. 2 with image from Diz-Munoz et al., 2010
Phenotype of all Fish created by or utilizing MO2-ezrb
Phenotype Fish Conditions Figures
pronephric tubule has fewer parts of type pronephric tubule microvillus, abnormal AB/TL + MO2-ezrb standard conditions Fig. 3 with image from Epting et al., 2015
pronephros cystic, abnormal AB/TL + MO2-ezrb standard conditions Fig. 3 with image from Epting et al., 2015
brain hydrocephalic, abnormal AB/TL + MO2-ezrb standard conditions Fig. 3 with image from Epting et al., 2015
pronephros cilium assembly decreased process quality, abnormal AB/TL + MO2-ezrb standard conditions Fig. 3 with image from Epting et al., 2015
pronephric glomerulus cystic, abnormal TU + MO2-ezrb standard conditions Fig. 2Fig. 3 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 3,4,5-trisphosphate mislocalised, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
post-vent region curved ventral, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct ciliary basal body mislocalised, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephros morphogenesis decreased process quality, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate mislocalised, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct cilium assembly decreased occurrence, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct filamentous actin mislocalised, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct has fewer parts of type pronephric duct motile cilium, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct actin filament bundle distribution decreased process quality, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct obsolete ciliary basal body-plasma membrane docking decreased process quality, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
pronephric duct apical plasma membrane ab1-atp1a1 labeling mislocalised, abnormal TU + MO2-ezrb standard conditions Fig. 2 from Xu et al., 2017
anterior axial hypoblast bleb increased amount, abnormal WT + MO2-ezrb standard conditions Fig. 2 with image from Diz-Munoz et al., 2010
regulation of cell projection assembly process quality, abnormal WT + MO2-ezrb standard conditions Fig. 2 with image from Diz-Munoz et al., 2010
prechordal plate formation decreased process quality, abnormal WT + MO2-ezrb standard conditions Fig. 3 with image from Diz-Munoz et al., 2010
anterior axial hypoblast bleb increased size, abnormal WT + MO2-ezrb standard conditions Fig. 2 with image from Diz-Munoz et al., 2010
anterior axial hypoblast lamellipodium decreased amount, abnormal WT + MO2-ezrb standard conditions Fig. 2 with image from Diz-Munoz et al., 2010
cell migration involved in mesendoderm migration decreased process quality, abnormal WT + MO2-ezrb standard conditions Fig. 3 with image from Diz-Munoz et al., 2010
anterior axial hypoblast filopodium decreased amount, abnormal WT + MO2-ezrb standard conditions Fig. 2 with image from Diz-Munoz et al., 2010
cytoskeleton organization decreased process quality, abnormal WT + MO2-ezrb standard conditions Fig. 2 with image from Diz-Munoz et al., 2010
anterior axial hypoblast decreased cellular motility, abnormal WT + MO2-ezrb standard conditions Fig. 3 with image from Diz-Munoz et al., 2010
pronephros cystic, abnormal li1Tg + MO2-ezrb standard conditions Fig. 3 with image from Epting et al., 2015
pronephric glomerulus cystic, exacerbated TU + MO1-inpp5e + MO2-ezrb standard conditions Fig. 3 from Xu et al., 2017
Citations