Morpholino
MO1-dab2
- ID
- ZDB-MRPHLNO-060919-1
- Name
- MO1-dab2
- Previous Names
-
- dab2MO (1)
- Target
- Sequence
-
5' - TTCTGCTTCAGGTGACTGTGACATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targeted to translation-start
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dab2
No data available
Phenotype
Phenotype resulting from MO1-dab2
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-dab2
1 - 5 of 11 Show all
Citations
- Neal, A., Nornes, S., Payne, S., Wallace, M.D., Fritzsche, M., Louphrasitthiphol, P., Wilkinson, R.N., Chouliaras, K.M., Liu, K., Plant, K., Sholapurkar, R., Ratnayaka, I., Herzog, W., Bond, G., Chico, T., Bou-Gharios, G., De Val, S. (2019) Venous identity requires BMP signalling through ALK3. Nature communications. 10:453
- Kim, J.D., Kang, H., Larrivée, B., Lee, M.Y., Mettlen, M., Schmid, S.L., Roman, B.L., Qyang, Y., Eichmann, A., and Jin, S.W. (2012) Context-dependent proangiogenic function of bone morphogenetic protein signaling is mediated by disabled homolog 2. Developmental Cell. 23(2):441-448
- Anzenberger, U., Bit-Avragim, N., Rohr, S., Rudolph, F., Dehmel, B., Willnow, T.E., and Abdelilah-Seyfried, S. (2006) Elucidation of megalin/LRP2-dependent endocytic transport processes in the larval zebrafish pronephros. Journal of Cell Science. 119(10):2127-2137
1 - 3 of 3
Show