Morpholino
MO3-sufu
- ID
- ZDB-MRPHLNO-060828-2
- Name
- MO3-sufu
- Previous Names
-
- Su(fu) MO (1)
- Target
- Sequence
-
5' - GCTGCTAGGCCGCATCTCATCCATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sufu
No data available
Phenotype
Phenotype resulting from MO3-sufu
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO3-sufu
1 - 5 of 5
Citations
- Sun, L., Li, P., Carr, A.L., Gorsuch, R., Yarka, C., Li, J., Bartlett, M., Pfister, D., Hyde, D.R., and Li, L. (2014) Transcription of the SCL/TAL1 interrupting locus (Stil) is required for cell proliferation in adult zebrafish retinas. The Journal of biological chemistry. 289(10):6934-40
- Li, J., Li, P., Carr, A., Wang, X., Delapaz, A., Sun, L., Lee, E., Tomei, E., and Li, L. (2013) Functional expression of SCL/TAL1 interrupting locus (Stil) protects retinal dopaminergic cells from neurotoxin-induced degeneration. The Journal of biological chemistry. 288(2):886-893
- Liu, S., Li, Z., and Gui, J.F. (2009) Fish-specific duplicated dmrt2b contributes to a divergent function through Hedgehog pathway and maintains left-right asymmetry establishment function. PLoS One. 4(9):e7261
- Koudijs, M.J., den Broeder, M.J., Keijser, A., Wienholds, E., Houwing, S., van Rooijen, E.M., Geisler, R., and van Eeden, F.J. (2005) The Zebrafish Mutants dre, uki, and lep Encode Negative Regulators of the Hedgehog Signaling Pathway. PLoS Genetics. 1(2):e19
1 - 4 of 4
Show