Morpholino
MO1-szl
- ID
- ZDB-MRPHLNO-060818-2
- Name
- MO1-szl
- Previous Names
-
- szz MO (1)
- Target
- Sequence
-
5' - ACAGCAGCAGACTGAATAGAGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-szl
No data available
Phenotype
Phenotype resulting from MO1-szl
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism wholly ventralized, abnormal | WT + MO1-szl |
Fig. 4 text only from Dal-Pra et al., 2006 |
Phenotype of all Fish created by or utilizing MO1-szl
Citations