Morpholino
MO1-dcaf7
- ID
- ZDB-MRPHLNO-060811-1
- Name
- MO1-dcaf7
- Previous Names
-
- MO1-wdr68
- wdr68MO (1)
- Target
- Sequence
-
5' - CGTTTACCGTGCAACGACATGCTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dcaf7
No data available
Phenotype
Phenotype resulting from MO1-dcaf7
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO1-dcaf7
1 - 5 of 24 Show all
Citations
- Alvarado, E., Yousefelahiyeh, M., Alvarado, G., Shang, R., Whitman, T., Martinez, A., Yu, Y., Pham, A., Bhandari, A., Wang, B., Nissen, R.M. (2016) Wdr68 Mediates Dorsal and Ventral Patterning Events for Craniofacial Development. PLoS One. 11:e0166984
- Wang, B., Doan, D., Roman Petersen, Y., Alvarado, E., Alvarado, G., Bhandari, A., Mohanty, A., Mohanty, S., and Nissen, R.M. (2013) Wdr68 requires nuclear access for craniofacial development. PLoS One. 8(1):e54363
- Mazmanian, G., Kovshilovsky, M., Yen, D., Mohanty, A., Mohanty, S., Nee, A., and Nissen, R.M. (2010) The zebrafish dyrk1b gene is important for endoderm formation. Genesis (New York, N.Y. : 2000). 48(1):20-30
- Nissen, R.M., Amsterdam, A., and Hopkins, N. (2006) A zebrafish screen for craniofacial mutants identifies wdr68 as a highly conserved gene required for Endothelin-1 expression. BMC Developmental Biology. 6:28
1 - 4 of 4
Show