Morpholino
MO1-gipc1
- ID
- ZDB-MRPHLNO-060726-1
- Name
- MO1-gipc1
- Previous Names
-
- MO-ATG-1 (1)
- Target
- Sequence
-
5' - CGTCCCAATCCAAGTGGCATTTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation-start blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gipc1
No data available
Phenotype
Phenotype resulting from MO1-gipc1
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-gipc1
1 - 5 of 19 Show all
Citations
- Hermans, K., Claes, F., Vandevelde, W., Zheng, W., Geudens, I., Orsenigo, F., De Smet, F., Gjini, E., Anthonis, K., Ren, B., Kerjaschki, D., Autiero, M., Ny, A., Simons, M., Dewerchin, M., Schulte-Merker, S., Dejana, E., Alitalo, K., and Carmeliet, P. (2010) Role of synectin in lymphatic development in zebrafish and frogs. Blood. 116(17):3356-3366
- Ren, B., Deng, Y., Mukhopadhyay, A., Lanahan, A.A., Zhuang, Z.W., Moodie, K.L., Mulligan-Kehoe, M.J., Byzova, T.V., Peterson, R.T., and Simons, M. (2010) ERK1/2-Akt1 crosstalk regulates arteriogenesis in mice and zebrafish. J. Clin. Invest.. 120(4):1217-1228
- Chittenden, T.W., Claes, F., Lanahan, A.A., Autiero, M., Palac, R.T., Tkachenko, E.V., Elfenbein, A., Ruiz de Almodovar, C., Dedkov, E., Tomanek, R., Li, W., Westmore, M., Singh, J., Horowitz, A., Mulligan-Kehoe, M.J., Moodie, K.L., Zhuang, Z.W., Carmeliet, P., and Simons, M. (2006) Selective regulation of arterial branching morphogenesis by synectin. Developmental Cell. 10(6):783-795
1 - 3 of 3
Show