Morpholino
MO1-rerea
- ID
- ZDB-MRPHLNO-060718-2
- Name
- MO1-rerea
- Previous Names
-
- MO1-rere (1)
- Target
- Sequence
-
5' - TCCTTGGAGGCTGTAAACACAAATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rerea
No data available
Phenotype
Phenotype resulting from MO1-rerea
| Phenotype | Fish | Figures |
|---|---|---|
| optic stalk pax2a expression increased distribution, abnormal | AB/TL + MO1-rerea |
Fig. 7 
from George et al., 2022 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-rerea
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| optic stalk pax2a expression increased distribution, abnormal | AB/TL + MO1-rerea | standard conditions |
Fig. 7
from George et al., 2022 |
1 - 1 of 1
Citations
- George, A., Lee, J., Liu, J., Kim, S., Brooks, B.P. (2022) Zebrafish model of RERE syndrome recapitulates key ophthalmic defects that are rescued by small molecule inhibitor of shh signaling. Developmental Dynamics : an official publication of the American Association of Anatomists. 252(4):495-509
- Zhang, Z., Feng, J., Pan, C., Lv, X., Wu, W., Zhou, Z., Liu, F., Zhang, L., and Zhao, Y. (2013) Atrophin-Rpd3 complex represses Hedgehog signaling by acting as a corepressor of CiR. The Journal of cell biology. 203(4):575-583
- Asai, Y., Chan, D.K., Starr, C.J., Kappler, J.A., Kollmar, R., and Hudspeth, A.J. (2006) Mutation of the atrophin2 gene in the zebrafish disrupts signaling by fibroblast growth factor during development of the inner ear. Proceedings of the National Academy of Sciences of the United States of America. 103(24):9069-9074
1 - 3 of 3
Show