Morpholino
MO1-sema3fa
- ID
- ZDB-MRPHLNO-060705-7
- Name
- MO1-sema3fa
- Previous Names
- None
- Target
- Sequence
-
5' - TATCCATAAAACCCACAAGAGATTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema3fa
No data available
Phenotype
Phenotype resulting from MO1-sema3fa
No data available
Phenotype of all Fish created by or utilizing MO1-sema3fa
1 - 5 of 10 Show all
Citations
- Plant, T., Eamsamarng, S., Sanchez-Garcia, M.A., Reyes, L., Renshaw, S.A., Coelho, P., Mirchandani, A.S., Morgan, J.M., Ellett, F.E., Morrison, T., Humphries, D., Watts, E.R., Murphy, F., Raffo-Iraolagoitia, X.L., Zhang, A., Cash, J.L., Loynes, C., Elks, P.M., Van Eeden, F., Carlin, L.M., Furley, A.J.W., Whyte, M.K.B., Walmsley, S.R. (2020) Semaphorin 3F signaling actively retains neutrophils at sites of inflammation. The Journal of Clinical Investigation. 130(6):3221-3237
- Kuan, Y.S., Yu, H.H., Moens, C.B., and Halpern, M.E. (2007) Neuropilin asymmetry mediates a left-right difference in habenular connectivity. Development (Cambridge, England). 134(5):857-865
- Yu, H.H., and Moens, C.B. (2005) Semaphorin signaling guides cranial neural crest cell migration in zebrafish. Developmental Biology. 280(2):373-385
1 - 3 of 3
Show