Morpholino
MO1-crb2b
- ID
- ZDB-MRPHLNO-060612-1
- Name
- MO1-crb2b
- Previous Names
- Target
- Sequence
-
5' - ACATCCGTCCAAAATCCATGTCCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-crb2b
No data available
Phenotype
Phenotype resulting from MO1-crb2b
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-crb2b
1 - 5 of 11 Show all
Citations
- Zou, J., Wen, Y., Yang, X., and Wei, X. (2013) Spatial-temporal expressions of Crumbs and Nagie oko and their interdependence in zebrafish central nervous system during early development. International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience. 31(8):770-782
- He, B., Ebarasi, L., Hultenby, K., Tryggvason, K., and Betsholtz, C. (2011) Podocin-Green Fluorescence Protein Allows Visualization and Functional Analysis of Podocytes. Journal of the American Society of Nephrology : JASN. 22(6):1019-1023
- Ebarasi, L., He, L., Hultenby, K., Takemoto, M., Betsholtz, C., Tryggvason, K., and Majumdar, A. (2009) A reverse genetic screen in the zebrafish identifies crb2b as a regulator of the glomerular filtration barrier. Developmental Biology. 334(1):1-9
- Omori, Y., and Malicki, J. (2006) oko meduzy and Related crumbs Genes Are Determinants of Apical Cell Features in the Vertebrate Embryo. Current biology : CB. 16(10):945-957
1 - 4 of 4
Show