Morpholino
MO1-slc2a1a
- ID
- ZDB-MRPHLNO-060608-3
- Name
- MO1-slc2a1a
- Previous Names
-
- MO1-slc2a1
- glut1 start MO
- Target
- Sequence
-
5' - GGCCATCATCAGCTGAGGAGTCACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc2a1a
No data available
Phenotype
Phenotype resulting from MO1-slc2a1a
1 - 5 of 20 Show all
Phenotype of all Fish created by or utilizing MO1-slc2a1a
1 - 5 of 32 Show all
Citations
- Morioka, S., Perry, J.S.A., Raymond, M.H., Medina, C.B., Zhu, Y., Zhao, L., Serbulea, V., Onengut-Gumuscu, S., Leitinger, N., Kucenas, S., Rathmell, J.C., Makowski, L., Ravichandran, K.S. (2018) Efferocytosis induces a novel SLC program to promote glucose uptake and lactate release. Nature. 563:714-718
- Carayannopoulos, M.O., Xiong, F., Jensen, P., Rios-Galdamez, Y., Huang, H., Lin, S., Devaskar, S.U. (2014) GLUT3 gene expression is critical for embryonic growth, brain development and survival. Molecular genetics and metabolism. 111:477-83
- Harris, J.M., Esain, V., Frechette, G.M., Harris, L.J., Cox, A.G., Cortes, M., Garnaas, M.K., Carroll, K.J., Cutting, C.C., Khan, T., Elks, P.M., Renshaw, S.A., Dickinson, B.C., Chang, C.J., Murphy, M.P., Paw, B.H., Vander Heiden, M.G., Goessling, W., and North, T.E. (2013) Glucose metabolism impacts the spatio-temporal onset and magnitude of HSC induction in vivo. Blood. 121(13):2483-2493
- Jensen, P.J., Gunter, L.B., and Carayannopoulos, M.O. (2010) AKT2 modulates glucose availability and downstream apoptotic pathways during development. The Journal of biological chemistry. 285(23):17673-17680
- Jensen, P.J., Gitlin, J.D., and Carayannopoulos, M.O. (2006) GLUT1 deficiency links nutrient availability and apoptosis during embryonic development. The Journal of biological chemistry. 281(19):13382-13387
1 - 5 of 5
Show