Morpholino
MO2-psenen
- ID
- ZDB-MRPHLNO-060331-2
- Name
- MO2-psenen
- Previous Names
-
- Pen2 - MO2 (1)
- Target
- Sequence
-
5' - TTTCCTTAAAAGACGAGCACAGACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-psenen
No data available
Phenotype
Phenotype resulting from MO2-psenen
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO2-psenen
1 - 4 of 4
Citations
- Ralser, D.J., Basmanav, F.B., Tafazzoli, A., Wititsuwannakul, J., Delker, S., Danda, S., Thiele, H., Wolf, S., Busch, M., Pulimood, S.A., Altmüller, J., Nürnberg, P., Lacombe, D., Hillen, U., Wenzel, J., Frank, J., Odermatt, B., Betz, R.C. (2017) Mutations in γ-secretase subunit-encoding PSENEN underlie Dowling-Degos disease associated with acne inversa. The Journal of Clinical Investigation. 127(4):1485-1490
- Campbell, W.A., Yang, H., Zetterberg, H., Baulac, S., Sears, J.A., Liu, T., Wong, S.T., Zhong, T.P., and Xia, W. (2006) Zebrafish lacking Alzheimer presenilin enhancer 2 (Pen-2) demonstrate excessive p53-dependent apoptosis and neuronal loss. Journal of neurochemistry. 96(5):1423-1440
- Liu, T., Lu, J., Wang, Y., Campbell, W.A., Huang, L., Zhu, J., Xia, W., and Wong, S.T.C. (2006) Computerized image analysis for quantitative neuronal phenotyping in zebrafish. Journal of Neuroscience Methods. 153(2):190-202
1 - 3 of 3
Show