Morpholino
MO1-cyp11a1.1
- ID
- ZDB-MRPHLNO-060301-3
- Name
- MO1-cyp11a1.1
- Previous Names
-
- MO1-cyp11a1
- scc mo1 (1)
- Target
- Sequence
-
5' - GCCATCACACTCTCTCTCTCTACTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp11a1.1
No data available
Phenotype
Phenotype resulting from MO1-cyp11a1.1
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-cyp11a1.1
1 - 5 of 10 Show all
Citations
- Li, Y., Li, X., Ye, D., Zhang, R., Liu, C., He, M., Wang, H., Hu, W., Sun, Y. (2024) Endogenous biosynthesis of docosahexaenoic acid (DHA) regulates fish oocyte maturation by promoting pregnenolone production. Zoological research. 45:176188176-188
- Eckerle, S., Ringler, M., Lecaudey, V., Nitschke, R., Driever, W. (2017) Progesterone modulates microtubule dynamics and epiboly progression during zebrafish gastrulation. Developmental Biology. 434(2):249-266
- Parajes, S., Griffin, A., Taylor, A.E., Rose, I.T., Miguel-Escalada, I., Hadzhiev, Y., Arlt, W., Shackleton, C., Muller, F., and Krone, N. (2013) Redefining the initiation and maintenance of zebrafish interrenal steroidogenesis by characterizing the key enzyme Cyp11a2. Endocrinology. 154(8):2702-11
- Weng, J.H., Liang, M.R., Chen, C.H., Tong, S.K., Huang, T.C., Lee, S.P., Chen, Y.R., Chen, C.T., and Chung, B.C. (2013) Pregnenolone activates CLIP-170 to promote microtubule growth and cell migration. Nature Chemical Biology. 9(10):636-42
- Hsu, H.J., Hsu, N.C., Hu, M.C., and Chung, B.C. (2006) Steroidogenesis in zebrafish and mouse models. Molecular and Cellular Endocrinology. 248(1-2):160-163
- Hsu, H.J., Liang, M.R., Chen, C.T., and Chung, B.C. (2006) Pregnenolone stabilizes microtubules and promotes zebrafish embryonic cell movement. Nature. 439(7075):480-483
1 - 6 of 6
Show