Morpholino
MO2-ptges
- ID
- ZDB-MRPHLNO-060220-2
- Name
- MO2-ptges
- Previous Names
- None
- Target
- Sequence
-
5' - GTTTTGTGCTCTTACCTCCTACAGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocker targeted to first intron-exon boundary
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ptges
No data available
Phenotype
Phenotype resulting from MO2-ptges
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-ptges
1 - 5 of 9 Show all
Citations
- Loynes, C.A., Lee, J.A., Robertson, A.L., Steel, M.J., Ellett, F., Feng, Y., Levy, B.D., Whyte, M.K.B., Renshaw, S.A. (2018) PGE2 production at sites of tissue injury promotes an anti-inflammatory neutrophil phenotype and determines the outcome of inflammation resolution in vivo.. Science advances. 4:eaar8320
- Esain, V., Kwan, W., Carroll, K.J., Cortes, M., Liu, S.Y., Frechette, G.M., Sheward, L.M., Nissim, S., Goessling, W., North, T.E. (2015) Cannabinoid Receptor-2 Regulates Embryonic Hematopoietic Stem Cell Development via PGE2 and P-selectin Activity. Stem cells (Dayton, Ohio). 33(8):2596-612
- Nissim, S., Sherwood, R.I., Wucherpfennig, J., Saunders, D., Harris, J.M., Esain, V., Carroll, K.J., Frechette, G.M., Kim, A.J., Hwang, K.L., Cutting, C.C., Elledge, S., North, T.E., and Goessling, W. (2014) Prostaglandin E2 regulates liver versus pancreas cell-fate decisions and endodermal outgrowth. Developmental Cell. 28(4):423-437
- Feng, Y., Renshaw, S., and Martin, P. (2012) Live Imaging of Tumor Initiation in Zebrafish Larvae Reveals a Trophic Role for Leukocyte-Derived PGE(2). Current biology : CB. 22(13):1253-1259
- Nguyen, A.T., Emelyanov, A., Koh, C.H., Spitsbergen, J.M., Lam, S.H., Mathavan, S., Parinov, S., and Gong, Z. (2011) A high level of liver-specific expression of oncogenic KrasV12 drives robust liver tumorigenesis in transgenic zebrafish. Disease models & mechanisms. 4(6):801-13
- Quesada-Hernández, E., Caneparo, L., Schneider, S., Winkler, S., Liebling, M., Fraser, S.E., and Heisenberg, C.P. (2010) Stereotypical Cell Division Orientation Controls Neural Rod Midline Formation in Zebrafish. Current biology : CB. 20(21):1966-1972
- Speirs, C.K., Jernigan, K.K., Kim, S.H., Cha, Y.I., Lin, F., Sepich, D.S., DuBois, R.N., Lee, E., and Solnica-Krezel, L. (2010) Prostaglandin Gbetagamma signaling stimulates gastrulation movements by limiting cell adhesion through Snai1a stabilization. Development (Cambridge, England). 137(8):1327-1337
- North, T.E., Goessling, W., Walkley, C.R., Lengerke, C., Kopani, K.R., Lord, A.M., Weber, G.J., Bowman, T.V., Jang, I.H., Grosser, T., Fitzgerald, G.A., Daley, G.Q., Orkin, S.H., and Zon, L.I. (2007) Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature. 447(7147):1007-1011
- Cha, Y.I., Kim, S.H., Sepich, D., Buchanan, F.G., Solnica-Krezel, L., and Dubois, R.N. (2006) Cyclooxygenase-1-derived PGE2 promotes cell motility via the G-protein-coupled EP4 receptor during vertebrate gastrulation. Genes & Development. 20(1):77-86
1 - 9 of 9
Show