Morpholino

MO1-rab5c

ID
ZDB-MRPHLNO-060206-2
Name
MO1-rab5c
Previous Names
  • rab5c-MO (1)
Target
Sequence
5' - CGCTGGTCCACCTCGCCCCGCCATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab5c
Phenotype
Phenotype resulting from MO1-rab5c
Phenotype Fish Figures
artery Venus expression decreased amount, abnormal s843Tg; s940Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
artery Venus expression decreased distribution, abnormal s843Tg; s940Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
brain necrotic, abnormal WT + MO1-rab5c + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
caudal fin curved, abnormal WT + MO1-rab5c Fig. 2 with image from Kenyon et al., 2015
DEL increased thickness, abnormal AB/TL + MO1-rab5c Fig. 3 with image from Song et al., 2013
endothelial tip cell Venus expression decreased amount, abnormal s843Tg; s940Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
endothelial tip cell Venus expression decreased distribution, abnormal s843Tg; s940Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
endothelial tip cell filopodium decreased length, abnormal mu240Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
epiboly delayed, abnormal AB/TL + MO1-rab5c Fig. 3 with image from Song et al., 2013
forebrain morphology, abnormal WT + MO1-rab5c + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
head decreased size, abnormal WT + MO1-rab5c Fig. 2 with image from Kenyon et al., 2015
head hypoplastic, abnormal WT + MO1-rab5c + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
intersegmental vessel Venus expression decreased amount, abnormal s843Tg; s940Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
intersegmental vessel decreased amount, abnormal s843Tg + MO1-rab5c Fig. 4 with image from Kempers et al., 2021
intersegmental vessel Venus expression decreased distribution, abnormal s843Tg; s940Tg + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
intersegmental vessel decreased height, abnormal s843Tg + MO1-rab5c Fig. 4 with image from Kempers et al., 2021
intersegmental vessel spatial pattern, abnormal s843Tg + MO1-rab5c Fig. 4 with image from Kempers et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal s843Tg + MO1-rab5c Fig. 4 with image from Kempers et al., 2021
notochord cell malformed, abnormal WT + MO1-rab5c Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c Fig. 2 with image from Kenyon et al., 2015
whole organism Ab2-kdrl labeling decreased amount, abnormal WT + MO1-rab5c Fig. 5 with image from Kempers et al., 2021
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5c + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5c Fig. 2 with image from Kenyon et al., 2015
Phenotype of all Fish created by or utilizing MO1-rab5c
Phenotype Fish Conditions Figures
epiboly delayed, abnormal AB/TL + MO1-rab5c standard conditions Fig. 3 with image from Song et al., 2013
DEL increased thickness, abnormal AB/TL + MO1-rab5c standard conditions Fig. 3 with image from Song et al., 2013
head decreased size, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism Ab2-kdrl labeling decreased amount, abnormal WT + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
brain necrotic, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
caudal fin curved, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
notochord cell malformed, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain morphology, abnormal WT + MO1-rab5c standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain morphology, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head hypoplastic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle disorganized, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite U-shaped, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5c + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
endothelial tip cell filopodium decreased length, abnormal mu240Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
intersegmental vessel decreased height, abnormal s843Tg + MO1-rab5c control Fig. 4 with image from Kempers et al., 2021
intersegmental vessel spatial pattern, abnormal s843Tg + MO1-rab5c control Fig. 4 with image from Kempers et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal s843Tg + MO1-rab5c control Fig. 4 with image from Kempers et al., 2021
intersegmental vessel decreased amount, abnormal s843Tg + MO1-rab5c control Fig. 4 with image from Kempers et al., 2021
artery Venus expression decreased distribution, abnormal s843Tg; s940Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
intersegmental vessel Venus expression decreased distribution, abnormal s843Tg; s940Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
endothelial tip cell Venus expression decreased distribution, abnormal s843Tg; s940Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
endothelial tip cell Venus expression decreased amount, abnormal s843Tg; s940Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
intersegmental vessel Venus expression decreased amount, abnormal s843Tg; s940Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
artery Venus expression decreased amount, abnormal s843Tg; s940Tg + MO1-rab5c control Fig. 5 with image from Kempers et al., 2021
Citations