Morpholino
MO1-crx
- ID
- ZDB-MRPHLNO-060127-1
- Name
- MO1-crx
- Previous Names
-
- MO4-crx (1)
- Target
- Sequence
-
5' - ATGTAGGACATCATTCTTGGGACGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-crx
No data available
Phenotype
Phenotype resulting from MO1-crx
| Phenotype | Fish | Figures |
|---|---|---|
| visual behavior disrupted, abnormal | WT + MO1-crx |
Fig. 3
from Pretorius et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-crx
1 - 3 of 3
Citations
- Pretorius, P.R., Aldahmesh, M.A., Alkuraya, F.S., Sheffield, V.C., and Slusarski, D.C. (2011) Functional analysis of BBS3 A89V that results in non-syndromic retinal degeneration. Human molecular genetics. 20(8):1625-1632
- Chen, H., Leung, T., Giger, K.E., Stauffer, A.M., Humbert, J.E., Sinha, S., Horstick, E.J., Hansen, C.A., and Robishaw, J.D. (2007) Expression of the G protein gammaT1 subunit during zebrafish development. Gene expression patterns : GEP. 7(5):574-583
- Shen, Y.C., and Raymond, P.A. (2004) Zebrafish cone-rod (crx) homeobox gene promotes retinogenesis. Developmental Biology. 269(1):237-251
- Gamse, J.T., Shen, Y.-C., Thisse, C., Thisse, B., Raymond, P.A., Halpern, M.E., and Liang, J.O. (2002) Otx5 regulates genes that show circadian expression in the zebrafish pineal complex. Nature Genetics. 30(1):117-121
1 - 4 of 4
Show