Morpholino
MO1-spaw
- ID
- ZDB-MRPHLNO-060112-1
- Name
- MO1-spaw
- Previous Names
- None
- Target
- Sequence
-
5' - GCACGCTATGACTGGCTGCATTGCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The authors report using a single base substitution to reduce MO secondary structure. This morpholino is directed against the start site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spaw
No data available
Phenotype
Phenotype resulting from MO1-spaw
1 - 5 of 24 Show all
Phenotype of all Fish created by or utilizing MO1-spaw
1 - 5 of 27 Show all
Citations
- Lombardo, V.A., Heise, M., Moghtadaei, M., Bornhorst, D., Männer, J., Abdelilah-Seyfried, S. (2019) Morphogenetic control of zebrafish cardiac looping by Bmp signaling. Development (Cambridge, England). 146(22):
- Roussigné, M., Wei, L., Tsingos, E., Kuchling, F., Alkobtawi, M., Tsalavouta, M., Wittbrodt, J., Carl, M., Blader, P., Wilson, S.W. (2018) Left/right asymmetric collective migration of parapineal cells is mediated by focal FGF signaling activity in leading cells. Proceedings of the National Academy of Sciences of the United States of America. 115(42):E9812-E9821
- Facchin, L., Duboué, E.R., Halpern, M.E. (2015) Disruption of Epithalamic Left-Right Asymmetry Increases Anxiety in Zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 35:15847-59
- Nash, D., Arrington, C.B., Kennedy, B.J., Yandell, M., Wu, W., Zhang, W., Ware, S., Jorde, L.B., Gruber, P.J., Yost, H.J., Bowles, N.E., Bleyl, S.B. (2015) Shared Segment Analysis and Next-Generation Sequencing Implicates the Retinoic Acid Signaling Pathway in Total Anomalous Pulmonary Venous Return (TAPVR). PLoS One. 10:e0131514
- Colombo, A., Palma, K., Armijo, L., Mione, M., Signore, I.A., Morales, C., Guerrero, N., Meynard, M.M., Pérez, R., Suazo, J., Marcelain, K., Briones, L., Härtel, S., Wilson, S.W., and Concha, M.L. (2013) Daam1a mediates asymmetric habenular morphogenesis by regulating dendritic and axonal outgrowth. Development (Cambridge, England). 140(19):3997-4007
- Peterson, A.G., Wang, X., and Yost, H. J. (2013) Dvr1 transfers left-right asymmetric signals from Kupffer's vesicle to lateral plate mesoderm in zebrafish. Developmental Biology. 382(1):198-208
- Veerkamp, J., Rudolph, F., Cseresnyes, Z., Priller, F., Otten, C., Renz, M., Schaefer, L., and Abdelilah-Seyfried, S. (2013) Unilateral dampening of bmp activity by nodal generates cardiac left-right asymmetry. Developmental Cell. 24(6):660-667
- Huang, S., Ma, J., Liu, X., Zhang, Y., and Luo, L. (2011) Retinoic acid signaling sequentially controls visceral and heart laterality in Zebrafish. The Journal of biological chemistry. 286(32):28533-43
- Yin, C., Kikuchi, K., Hochgreb, T., Poss, K.D., and Stainier, D.Y. (2010) Hand2 Regulates Extracellular Matrix Remodeling Essential for Gut-Looping Morphogenesis in Zebrafish. Developmental Cell. 18(6):973-984
- Lin, X., and Xu, X. (2009) Distinct functions of Wnt/{beta}-catenin signaling in KV development and cardiac asymmetry. Development (Cambridge, England). 136(2):207-217
1 - 10 of 21
Show