Morpholino

MO1-spaw

ID
ZDB-MRPHLNO-060112-1
Name
MO1-spaw
Previous Names
None
Target
Sequence
5' - GCACGCTATGACTGGCTGCATTGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The authors report using a single base substitution to reduce MO secondary structure. This morpholino is directed against the start site.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-spaw
Expressed Gene Anatomy Figures
bmp4 Fig. 4 with image from Chocron et al., 2007
dand5 Fig. 1 with image from Gourronc et al., 2007
gsc Fig. 5 with image from Long et al., 2003
ins Fig. 5 with image from Long et al., 2003
lft1 Fig. 3 with image from Regan et al., 2009
Fig. 2 with image from Wang et al., 2008
Fig. 2 with image from Carl et al., 2007
Fig. 5 with image from Inbal et al., 2007
Fig. 6 with image,  Fig. 7 with image from Long et al., 2003
lft2 Fig. 6 with image from Lin et al., 2009
Fig. 7 with image from Long et al., 2003
myh9a Fig. 4 with image from Veerkamp et al., 2013
ndr2 Fig. 7 with image from Long et al., 2003
nkx2.5 Fig. 5 with image from Long et al., 2003
ntn1b Fig. 7 with image from Long et al., 2003
pitx2 Fig. 2 with image from Wang et al., 2008
Fig. 7 with image from Long et al., 2003
spaw Fig. 2 with image from Wang et al., 2008
Fig. 7 with image from Long et al., 2003
tbxta Fig. 6 with image from Long et al., 2003
tdgf1 Fig. 7 with image from Long et al., 2003
Phenotype
Phenotype resulting from MO1-spaw
Phenotype Fish Figures
cardioblast migration decreased process quality, abnormal md3Tg; y1Tg + MO1-spaw Fig. 3 with image from Veerkamp et al., 2013
cell migration involved in heart jogging decreased process quality, abnormal md3Tg; y1Tg + MO1-spaw Fig. 3 with image from Veerkamp et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal twu34Tg + MO1-spaw Fig. 4 with image from Veerkamp et al., 2013
determination of heart left/right asymmetry process quality, abnormal WT + MO1-spaw Fig. 5 with image from Long et al., 2003
determination of intestine left/right asymmetry disrupted, abnormal pd24Tg + MO1-spaw Fig. 1 with image from Yin et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-spaw Fig. 2 with image from Carl et al., 2007
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-spaw Fig. 5 with image from Long et al., 2003
embryonic heart tube elongation decreased process quality, abnormal twu34Tg + MO1-spaw Fig. 4 with image from Veerkamp et al., 2013
epithalamus determination of left/right symmetry disrupted, abnormal WT + MO1-spaw Fig. T1 with image from Roussigné et al., 2009
habenula determination of left/right symmetry disrupted, abnormal WT + MO1-spaw Fig. 5 with image from Roussigné et al., 2009
habenula neurogenesis process quality, abnormal WT + MO1-spaw Fig. 5 with image from Roussigné et al., 2009
heart development decreased process quality, abnormal WT + MO1-spaw Fig. 1 with image from Veerkamp et al., 2013
heart jogging process quality, abnormal WT + MO1-spaw Fig. 5 with image from Long et al., 2003
heart looping process quality, abnormal WT + MO1-spaw Fig. 5 with image from Long et al., 2003
heart morphogenesis process quality, abnormal twu34Tg + MO1-spaw Fig. 2 from Rohr et al., 2008
heart rudiment bilateral symmetry, abnormal twu34Tg + MO1-spaw Fig. 2 from Rohr et al., 2008
heart rudiment endocardial precursor mislocalised, abnormal md3Tg; y1Tg + MO1-spaw Fig. 3 with image from Veerkamp et al., 2013
heart rudiment myocardial precursor mislocalised, abnormal md3Tg; y1Tg + MO1-spaw Fig. 3 with image from Veerkamp et al., 2013
lateral plate mesoderm pitx2 expression absent, abnormal WT + MO1-spaw Fig. 2 with image from Wang et al., 2008
mesodermal cell migration disrupted, abnormal pd24Tg + MO1-spaw Fig. 1 with image from Yin et al., 2010
nodal signaling pathway disrupted, abnormal WT + MO1-spaw Fig. 5 with image from Roussigné et al., 2009
notochord lft1 expression absent, abnormal WT + MO1-spaw Fig. 2 with image from Wang et al., 2008
primitive heart tube bilateral symmetry, abnormal twu34Tg + MO1-spaw Fig. 4 with image from Veerkamp et al., 2013
primitive heart tube decreased length, abnormal twu34Tg + MO1-spaw Fig. 4 with image from Veerkamp et al., 2013
Phenotype of all Fish created by or utilizing MO1-spaw
Phenotype Fish Conditions Figures
lateral plate mesoderm pitx2 expression absent, abnormal WT + MO1-spaw standard conditions Fig. 2 with image from Wang et al., 2008
heart development decreased process quality, abnormal WT + MO1-spaw standard conditions Fig. 1 with image from Veerkamp et al., 2013
heart jogging process quality, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Long et al., 2003
determination of left/right symmetry disrupted, abnormal WT + MO1-spaw standard conditions Fig. 2 with image from Carl et al., 2007
habenula determination of left/right symmetry disrupted, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Roussigné et al., 2009
determination of heart left/right asymmetry process quality, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Long et al., 2003
heart looping process quality, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Long et al., 2003
habenula neurogenesis process quality, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Roussigné et al., 2009
notochord lft1 expression absent, abnormal WT + MO1-spaw standard conditions Fig. 2 with image from Wang et al., 2008
epithalamus determination of left/right symmetry disrupted, abnormal WT + MO1-spaw standard conditions Fig. T1 with image from Roussigné et al., 2009
nodal signaling pathway disrupted, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Roussigné et al., 2009
determination of pancreatic left/right asymmetry process quality, abnormal WT + MO1-spaw standard conditions Fig. 5 with image from Long et al., 2003
determination of left/right symmetry disrupted, abnormal WT + MO1-spaw + MO2-spaw standard conditions Fig. 3 with image from Smith et al., 2008
heart looping disrupted, abnormal WT + MO1-spaw + MO2-spaw standard conditions Fig. 3 with image from Smith et al., 2008
mesodermal cell migration disrupted, abnormal pd24Tg + MO1-spaw standard conditions Fig. 1 with image from Yin et al., 2010
determination of intestine left/right asymmetry disrupted, abnormal pd24Tg + MO1-spaw standard conditions Fig. 1 with image from Yin et al., 2010
determination of heart left/right asymmetry decreased process quality, abnormal twu34Tg + MO1-spaw standard conditions Fig. 4 with image from Veerkamp et al., 2013
primitive heart tube bilateral symmetry, abnormal twu34Tg + MO1-spaw standard conditions Fig. 4 with image from Veerkamp et al., 2013
heart rudiment bilateral symmetry, abnormal twu34Tg + MO1-spaw standard conditions Fig. 2 from Rohr et al., 2008
embryonic heart tube elongation decreased process quality, abnormal twu34Tg + MO1-spaw standard conditions Fig. 4 with image from Veerkamp et al., 2013
primitive heart tube decreased length, abnormal twu34Tg + MO1-spaw standard conditions Fig. 4 with image from Veerkamp et al., 2013
heart morphogenesis process quality, abnormal twu34Tg + MO1-spaw standard conditions Fig. 2 from Rohr et al., 2008
cell migration involved in heart jogging decreased process quality, abnormal md3Tg; y1Tg + MO1-spaw standard conditions Fig. 3 with image from Veerkamp et al., 2013
heart rudiment myocardial precursor mislocalised, abnormal md3Tg; y1Tg + MO1-spaw standard conditions Fig. 3 with image from Veerkamp et al., 2013
heart rudiment endocardial precursor mislocalised, abnormal md3Tg; y1Tg + MO1-spaw standard conditions Fig. 3 with image from Veerkamp et al., 2013
cardioblast migration decreased process quality, abnormal md3Tg; y1Tg + MO1-spaw standard conditions Fig. 3 with image from Veerkamp et al., 2013
determination of left/right symmetry disrupted, abnormal axin1tm213/tm213 + MO1-spaw standard conditions Fig. 2 with image from Carl et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.