Morpholino
MO1-ahr1a
- ID
- ZDB-MRPHLNO-060104-4
- Name
- MO1-ahr1a
- Previous Names
-
- E2I2-MO (1)
- Target
- Sequence
-
5' - CTTTTGAAGTGACTTTTGGCCCGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahr1a
No data available
Phenotype
Phenotype resulting from MO1-ahr1a
No data available
Phenotype of all Fish created by or utilizing MO1-ahr1a
1 - 5 of 19 Show all
Citations
- Garland, M.A., Geier, M.C., Bugel, S.M., Shankar, P., Dunham, C.L., Brown, J.M., Tilton, S.C., Tanguay, R.L. (2020) Aryl hydrocarbon receptor mediates larval zebrafish fin duplication following exposure to benzofluoranthenes. Toxicological sciences : an official journal of the Society of Toxicology. 176(1):46-64
- Geier, M.C., James Minick, D., Truong, L., Tilton, S., Pande, P., Anderson, K.A., Teeguardan, J., Tanguay, R.L. (2018) Systematic developmental neurotoxicity assessment of a representative PAH Superfund mixture using zebrafish. Toxicology and applied pharmacology. 354:115-125
- Chlebowski, A.C., Garcia, G.R., La Du, J.K., Bisson, W.H., Truong, L., Massey Simonich, S.L., Tanguay, R.L. (2017) Mechanistic Investigations Into the Developmental Toxicity of Nitrated and Heterocyclic PAHs. Toxicological sciences : an official journal of the Society of Toxicology. 157:246-259
- Gerlach, C.V., Das, S.R., Volz, D.C., Bisson, W.H., Kolluri, S.K., Tanguay, R.L. (2014) Mono-substituted isopropylated triaryl phosphate, a major component of Firemaster 550, is an AHR agonist that exhibits AHR-independent cardiotoxicity in zebrafish. Aquatic toxicology (Amsterdam, Netherlands). 154C:71-79
- Garner, L.V., Brown, D.R., and Di Giulio, R.T. (2013) Knockdown of AHR1A but not AHR1B exacerbates PAH and PCB-126 toxicity in zebrafish (Danio rerio) embryos. Aquatic toxicology (Amsterdam, Netherlands). 142-143:336-346
- Knecht, A.L., Goodale, B.C., Truong, L., Simonich, M.T., Swanson, A.J., Matzke, M.M., Anderson, K.A., Waters, K.M., and Tanguay, R.L. (2013) Comparative developmental toxicity of environmentally relevant oxygenated PAHs. Toxicology and applied pharmacology. 271(2):266-75
- Goodale, B.C., La Du, J.K., Bisson, W.H., Janszen, D.B., Waters, K.M., and Tanguay, R.L. (2012) AHR2 Mutant Reveals Functional Diversity of Aryl Hydrocarbon Receptors in Zebrafish. PLoS One. 7(1):e29346
- Incardona, J.P., Day, H.L., Collier, T.K., and Scholz, N.L. (2006) Developmental toxicity of 4-ring polycyclic aromatic hydrocarbons in zebrafish is differentially dependent on AH receptor isoforms and hepatic cytochrome P4501A metabolism. Toxicology and applied pharmacology. 217(3):308-321
- Incardona, J.P., Carls, M.G., Teraoka, H., Sloan, C.A., Collier, T.K., and Scholz, N.L. (2005) Aryl Hydrocarbon Receptor-Independent Toxicity of Weathered Crude Oil during Fish Development. Environmental health perspectives. 113(12):1755-1762
1 - 9 of 9
Show