Morpholino

MO3-vegfaa

ID
ZDB-MRPHLNO-051212-1
Name
MO3-vegfaa
Previous Names
  • MO3-vegf
  • MO3-vegfa
Target
Sequence
5' - CTCGTCTTATTTCCGTGACTGTTTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vegfaa
Expressed Gene Anatomy Figures
cdh5 Fig. 6 with image from Jin et al., 2005
dll4 Fig. 3 from Pan et al., 2012
flt4 Fig. 3 from Pan et al., 2012
Phenotype
Phenotype resulting from MO3-vegfaa
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO3-vegfaa Fig. 3 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal y1Tg + MO3-vegfaa Fig. 3 from Pan et al., 2012
blood vessel morphogenesis disrupted, abnormal WT + MO3-vegfaa Fig. 2 from Herbert et al., 2009
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa Fig. 5 with image from Fish et al., 2011
dorsal aorta aplastic, abnormal WT + MO3-vegfaa Fig. 2 from Herbert et al., 2009
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa Fig. 5 with image from Fish et al., 2011
intersegmental vessel aplastic, abnormal WT + MO3-vegfaa Fig. 2 from Herbert et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO3-vegfaa Fig. 3 from Pan et al., 2012
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa Fig. 5 with image from Fish et al., 2011
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal y1Tg + MO3-vegfaa Fig. 3,  Fig. 4 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal y1Tg + MO3-vegfaa Fig. 3,  Fig. 4 from Pan et al., 2012
sprouting angiogenesis disrupted, abnormal WT + MO3-vegfaa Fig. 2 from Herbert et al., 2009
Phenotype of all Fish created by or utilizing MO3-vegfaa
Phenotype Fish Conditions Figures
blood vessel morphogenesis disrupted, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
dorsal aorta aplastic, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
sprouting angiogenesis disrupted, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal WT + MO3-vegfaa standard conditions Fig. 2 from Herbert et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
positive regulation of ERK1 and ERK2 cascade decreased magnitude, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3,  Fig. 4 from Pan et al., 2012
blood vessel endothelial cell decreased amount, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3 from Pan et al., 2012
positive regulation of vascular endothelial growth factor signaling pathway decreased occurrence, abnormal y1Tg + MO3-vegfaa standard conditions Fig. 3,  Fig. 4 from Pan et al., 2012
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
endocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
embryonic heart tube morphogenesis decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
cardioblast migration to the midline involved in heart field formation decreased process quality, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
myocardium mislocalised, abnormal s896Tg; twu26Tg + MO1-robo1 + MO3-vegfaa standard conditions Fig. 5 with image from Fish et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.