Morpholino
MO2-vegfaa
- ID
- ZDB-MRPHLNO-051128-8
- Name
- MO2-vegfaa
- Previous Names
-
- MO2-vegf
- MO2-vegfa
- VEGF-A-3 (1)
- Target
- Sequence
-
5' - TAAGAAAGCGAAGCTGCTGGGTATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-vegfaa
No data available
Phenotype
Phenotype resulting from MO2-vegfaa
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-vegfaa
1 - 5 of 6 Show all
Citations
- Zhang, F., Zeng, Q.Y., Xu, H., Xu, A.N., Liu, D.J., Li, N.Z., Chen, Y., Jin, Y., Xu, C.H., Feng, C.Z., Zhang, Y.L., Liu, D., Liu, N., Xie, Y.Y., Yu, S.H., Yuan, H., Xue, K., Shi, J.Y., Liu, T.X., Xu, P.F., Zhao, W.L., Zhou, Y., Wang, L., Huang, Q.H., Chen, Z., Chen, S.J., Zhou, X.L., Sun, X.J. (2021) Selective and competitive functions of the AAR and UPR pathways in stress-induced angiogenesis. Cell discovery. 7:98
- De Angelis, J.E., Lagendijk, A.K., Chen, H., Tromp, A., Bower, N.I., Tunny, K.A., Brooks, A.J., Bakkers, J., Francois, M., Yap, A.S., Simons, C., Wicking, C., Hogan, B.M., Smith, K.A. (2017) Tmem2 Regulates Embryonic Vegf Signaling by Controlling Hyaluronic Acid Turnover. Developmental Cell. 40:123-136
- Kartopawiro, J., Bower, N.I., Karnezis, T., Kazenwadel, J., Betterman, K.L., Lesieur, E., Koltowska, K., Astin, J., Crosier, P., Vermeren, S., Achen, M.G., Stacker, S.A., Smith, K.A., Harvey, N.L., François, M., and Hogan, B.M. (2014) Arap3 is dysregulated in a mouse model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular development. Human molecular genetics. 23(5):1286-97
- Kuroyanagi, J., Shimada, Y., Zhang, B., Ariyoshi, M., Umemoto, N., Nishimura, Y., Tanaka, T. (2014) Zinc finger MYND-type containing 8 promotes tumour angiogenesis via induction of vascular endothelial growth factor-A expression. FEBS letters. 588(18):3409-16
- Jia, D., Hasso, S.M., Chan, J., Filingeri, D., D'Amore, P.A., Rice, L., Pampo, C., Siemann, D.W., Zurakowski, D., Rodig, S.J., and Moses, M.A. (2013) Transcriptional repression of VEGF by ZNF24: mechanistic studies and vascular consequences in vivo. Blood. 121(4):707-715
- Christie, T.L., Carter, A., Rollins, E.L., and Childs, S.J. (2010) Syk and Zap-70 function redundantly to promote angioblast migration. Developmental Biology. 340(1):22-29
- Lemmens, R., Van Hoecke, A., Hersmus, N., Geelen, V., D'Hollander, I., Thijs, V., Van Den Bosch, L., Carmeliet, P., and Robberecht, W. (2007) Overexpression of mutant superoxide dismutase 1 causes a motor axonopathy in the zebrafish. Human molecular genetics. 16(19):2359-2365
- Alt, B., Elsalini, O.A., Schrumpf, P., Haufs, N., Lawson, N.D., Schwabe, G.C., Mundlos, S., Gruters, A., Krude, H., and Rohr, K.B. (2006) Arteries define the position of the thyroid gland during its developmental relocalisation. Development (Cambridge, England). 133(19):3797-3804
- Larson, J.D., Wadman, S.A., Chen, E., Kerley, L., Clark, K.J., Eide, M., Lippert, S., Nasevicius, A., Ekker, S.C., Hackett, P.B., and Essner, J.J. (2004) Expression of VE-cadherin in zebrafish embryos: A new tool to evaluate vascular development. Developmental Dynamics : an official publication of the American Association of Anatomists. 231(1):204-213
- Nasevicius, A., Larson, J., and Ekker, S.C. (2000) Distinct requirements for zebrafish angiogenesis revealed by a VEGF-A morphant. Yeast (Chichester, England). 17(4):294-301
1 - 10 of 10
Show