Morpholino
MO1-wwtr1
- ID
- ZDB-MRPHLNO-051101-2
- Name
- MO1-wwtr1
- Previous Names
-
- Taz MO1 (1)
- Target
- Sequence
-
5' - CTGGAGAGGATTACCGCTCATGGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wwtr1
No data available
Phenotype
Phenotype resulting from MO1-wwtr1
1 - 5 of 35 Show all
Phenotype of all Fish created by or utilizing MO1-wwtr1
1 - 5 of 44 Show all
Citations
- Cayuso, J., Xu, Q., Addison, M., Wilkinson, D.G. (2019) Actomyosin regulation by Eph receptor signaling couples boundary cell formation to border sharpness. eLIFE. 8:
- Fillatre, J., Fauny, J.D., Fels, J.A., Li, C., Goll, M., Thisse, C., Thisse, B. (2019) TEADs, Yap, Taz, Vgll4s transcription factors control the establishment of Left-Right asymmetry in Zebrafish. eLIFE. 8:
- Voltes, A., Hevia, C.F., Engel, C., Dingare, C., Calzolari, S., Terriente, J., Norden, C., Lecaudey, V., Pujades, C. (2019) Yap/Taz-TEAD activity links mechanical cues to progenitor cell behavior during zebrafish hindbrain segmentation. Development (Cambridge, England). 146(14):
- Merrick, D., Mistry, K., Wu, J., Gresko, N., Baggs, J.E., Hogenesch, J.B., Sun, Z., Caplan, M.J. (2018) Polycystin-1 regulates bone development through an interaction with the transcriptional co-activator taz. Human molecular genetics. 28(1):16-30
- Nagasawa-Masuda, A., Terai, K. (2017) Yap/Taz transcriptional activity is essential for vascular regression via Ctgf expression and actin polymerization. PLoS One. 12:e0174633
- Agarwala, S., Duquesne, S., Liu, K., Boehm, A., Grimm, L., Link, S., König, S., Eimer, S., Ronneberger, O., Lecaudey, V. (2015) Amotl2a interacts with the Hippo effector Yap1 and the Wnt/β-catenin effector Lef1 to control tissue size in zebrafish. eLIFE. 4:e08201
- Pappalardo, A., Porreca, I., Caputi, L., De Felice, E., Schulte-Merker, S., Zannini, M., Sordino, P. (2015) Thyroid development in zebrafish lacking Taz. Mechanisms of Development. 138 Pt 3:268-78
- Zhang, J., Yuan, S., Vasilyev, A., Amin Arnaout, M. (2015) The transcriptional coactivator Taz regulates proximodistal patterning of the pronephric tubule in zebrafish. Mechanisms of Development. 138 Pt 3:328-35
- Tian, Y., Kolb, R., Hong, J.H., Carroll, J., Li, D., You, J., Bronson, R., Yaffe, M.B., Zhou, J., and Benjamin, T. (2007) TAZ promotes PC2 degradation through a SCF{beta}-Trcp E3 Ligase Complex. Molecular and cellular biology. 27(18):6383-6395
- Hong, J.H., Hwang, E.S., McManus, M.T., Amsterdam, A., Tian, Y., Kalmukova, R., Mueller, E., Benjamin, T., Spiegelman, B.M., Sharp, P.A., Hopkins, N., and Yaffe, M.B. (2005) TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Science (New York, N.Y.). 309(5737):1074-1078
1 - 10 of 10
Show