Morpholino
MO1-sox4b
- ID
- ZDB-MRPHLNO-051013-1
- Name
- MO1-sox4b
- Previous Names
-
- mo1sox4b (1)
- Target
- Sequence
-
5' - GACTCAGTCTGATTGCACACAGTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a morpholino that targets the 5'UTR of the sox4b gene.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sox4b
No data available
Phenotype
Phenotype resulting from MO1-sox4b
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-sox4b
1 - 2 of 2
Citations
- Flasse, L., Stern, D.G., Pirson, J.L., Manfroid, I., Peers, B., and Voz, M.L. (2013) The bHLH transcription factor Ascl1a is essential for the specification of the intestinal secretory cells and mediates Notch signaling in the zebrafish intestine. Developmental Biology. 376(2):187-197
- Quiroz, Y., Lopez, M., Mavropoulos, A., Motte, P., Martial, J.A., Hammerschmidt, M., and Muller, M. (2012) The HMG-Box Transcription Factor Sox4b Is Required for Pituitary Expression of gata2a and Specification of Thyrotrope and Gonadotrope Cells in Zebrafish. Molecular endocrinology (Baltimore, Md.). 26(6):1014-1027
- Mavropoulos, A., Devos, N., Biemar, F., Zecchin, E., Argenton, F., Edlund, H., Motte, P., Martial, J.A., and Peers, B. (2005) sox4b is a key player of pancreatic alpha cell differentiation in zebrafish. Developmental Biology. 285(1):211-223
1 - 3 of 3
Show