Morpholino

MO4-tbx2b

ID
ZDB-MRPHLNO-051012-1
Name
MO4-tbx2b
Previous Names
  • Tbx2b-SP (1)
Target
Sequence
5' - AAAATATGGGTACATACCTTGTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino targeting the tbx2b gene.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tbx2b
Phenotype
Phenotype resulting from MO4-tbx2b
Phenotype Fish Figures
atrioventricular canal development disrupted, abnormal twu26Tg + MO4-tbx2b Fig. 4 with image from Sedletcaia et al., 2011
cell migration in diencephalon disrupted, abnormal zf104Tg + MO4-tbx2b Fig. 8 with image from Snelson et al., 2008
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO4-tbx2b Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO4-tbx2b Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO4-tbx2b Fig. 4 with image from Drummond et al., 2017
epithalamus development disrupted, abnormal zf104Tg + MO4-tbx2b Fig. 8 with image from Snelson et al., 2008
heart looping disrupted, abnormal twu26Tg + MO4-tbx2b Fig. 4 with image from Sedletcaia et al., 2011
parapineal organ has fewer parts of type parapineal organ neuron, abnormal sqet11Et + MO4-tbx2b Fig. 4 with image from Khuansuwan et al., 2016
parapineal organ has fewer parts of type cell, abnormal WT + MO4-tbx2b Fig. 7 with image from Clanton et al., 2013
parapineal organ neuron fate specification decreased occurrence, abnormal sqet11Et + MO4-tbx2b Fig. 4 with image from Khuansuwan et al., 2016
pineal complex gngt1 expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex otx5 expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex otomp expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex rdh5 expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex gngt2a expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex rgra expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex morphology, abnormal zf104Tg + MO4-tbx2b Fig. 8 with image from Snelson et al., 2008
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
Phenotype of all Fish created by or utilizing MO4-tbx2b
Phenotype Fish Conditions Figures
pineal complex otomp expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex gngt2a expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex rgra expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex rdh5 expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex otx5 expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex gngt1 expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pronephric proximal convoluted tubule increased length, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO4-tbx2b standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
parapineal organ has fewer parts of type cell, abnormal WT + MO4-tbx2b standard conditions Fig. 7 with image from Clanton et al., 2013
parapineal organ has fewer parts of type parapineal organ neuron, abnormal sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
parapineal organ neuron fate specification decreased occurrence, abnormal sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
atrioventricular canal development disrupted, abnormal twu26Tg + MO4-tbx2b standard conditions Fig. 4 with image from Sedletcaia et al., 2011
heart looping disrupted, abnormal twu26Tg + MO4-tbx2b standard conditions Fig. 4 with image from Sedletcaia et al., 2011
epithalamus development disrupted, abnormal zf104Tg + MO4-tbx2b standard conditions Fig. 8 with image from Snelson et al., 2008
cell migration in diencephalon disrupted, abnormal zf104Tg + MO4-tbx2b standard conditions Fig. 8 with image from Snelson et al., 2008
pineal complex morphology, abnormal zf104Tg + MO4-tbx2b standard conditions Fig. 8 with image from Snelson et al., 2008
parapineal organ has fewer parts of type cell, abnormal fgf8ax15/x15 + MO4-tbx2b standard conditions Fig. 7 with image from Clanton et al., 2013
parapineal organ has number of parapineal organ neuron, ameliorated noton1/n1; sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
parapineal organ neuron fate specification occurrence, ameliorated noton1/n1; sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
Citations