Morpholino

MO1-cdh4

ID
ZDB-MRPHLNO-050930-2
Name
MO1-cdh4
Previous Names
  • RcadMphA (1)
Target
Sequence
5' - AAGGAGGCAGATGTTTGTTATTCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdh4
No data available
Phenotype
Phenotype resulting from MO1-cdh4
Phenotype Fish Figures
amacrine cell differentiation disrupted, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
apoptotic process increased occurrence, abnormal WT + MO1-cdh4 Fig. 10 from Liu et al., 2007
Fig. 7 with image from Babb et al., 2005
brain disorganized, abnormal WT + MO1-cdh4 Fig. 1 with image from Babb et al., 2005
cell death increased occurrence, abnormal WT + MO1-cdh4 Fig. 5 with image from Wilson et al., 2007
cranial nerve decreased size, abnormal WT + MO1-cdh4 Fig. 4 with image from Wilson et al., 2007
cranial nerve II decreased thickness, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
cranial nerve II fasciculation, abnormal WT + MO1-cdh4 Fig. 4 with image from Babb et al., 2005
cranial nerve II sparse, abnormal WT + MO1-cdh4 Fig. 4 with imageFig. 9 with image from Babb et al., 2005
cranial nerve II truncated, abnormal WT + MO1-cdh4 Fig. 9 with image from Babb et al., 2005
eye decreased size, abnormal AB + MO1-cdh4 text only from Liu et al., 2007
text only from Wilson et al., 2007
Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Babb et al., 2005
fourth ventricle increased size, abnormal WT + MO1-cdh4 Fig. 1 with image from Babb et al., 2005
hindbrain decreased size, abnormal WT + MO1-cdh4 Fig. 1 with image from Babb et al., 2005
lateral line nerve decreased size, abnormal WT + MO1-cdh4 Fig. 4 with image from Wilson et al., 2007
lens apoptotic, abnormal WT + MO1-cdh4 Fig. 7 with image from Babb et al., 2005
lens decreased size, abnormal WT + MO1-cdh4 Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Babb et al., 2005
lens opaque, abnormal AB + MO1-cdh4 text only from Liu et al., 2007
neuromast decreased amount, abnormal WT + MO1-cdh4 Fig. 7 with imagetext only from Wilson et al., 2007
optic nerve development disrupted, abnormal WT + MO1-cdh4 Fig. 4 with image from Babb et al., 2005
optic tectum morphology, abnormal WT + MO1-cdh4 Fig. 8 with imageFig. 9 with image from Babb et al., 2005
photoreceptor cell differentiation disrupted, abnormal WT + MO1-cdh4 Fig. 5 with imageFig. 6 with image from Babb et al., 2005
posterior lateral line nerve decreased length, abnormal WT + MO1-cdh4 Fig. 6 with image from Wilson et al., 2007
posterior lateral line neuromast primordium migration decreased rate, abnormal WT + MO1-cdh4 Fig. 8 with image from Wilson et al., 2007
retina apoptotic, abnormal WT + MO1-cdh4 Fig. 7 with image from Babb et al., 2005
retina hypoplastic, abnormal WT + MO1-cdh4 Fig. 2 with image from Babb et al., 2005
retina lacks parts or has fewer parts of type amacrine cell, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
retina lacks parts or has fewer parts of type photoreceptor cell, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
retina structure, abnormal AB + MO1-cdh4 text only from Liu et al., 2007
retina development in camera-type eye disrupted, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
retina layer formation disrupted, abnormal WT + MO1-cdh4 Fig. 1 with imageFig. 2 with imageFig. 6 with image from Babb et al., 2005
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-cdh4 text only from Liu et al., 2007
retinal ganglion cell decreased amount, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
retinal ganglion cell lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO1-cdh4 Fig. 4 with image from Babb et al., 2005
retinal ganglion cell neuron projection physical object quality, abnormal WT + MO1-cdh4 Fig. 8 with imageFig. 9 with image from Babb et al., 2005
retinal ganglion cell axon guidance disrupted, abnormal WT + MO1-cdh4 Fig. 4 with imageFig. 9 with image from Babb et al., 2005
retinal ganglion cell layer decreased thickness, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
retinal ganglion cell layer disorganized, abnormal WT + MO1-cdh4 Fig. 4 with image from Babb et al., 2005
retinal ganglion cell layer sparse, abnormal WT + MO1-cdh4 Fig. 4 with imageFig. 5 with image from Babb et al., 2005
retinal ganglion cell layer compartment boundary rough, abnormal WT + MO1-cdh4 Fig. 5 with image from Babb et al., 2005
whole organism decreased length, abnormal WT + MO1-cdh4 Fig. 1 with image from Babb et al., 2005
Phenotype of all Fish created by or utilizing MO1-cdh4
Phenotype Fish Conditions Figures
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO1-cdh4 standard conditions text only from Liu et al., 2007
lens opaque, abnormal AB + MO1-cdh4 standard conditions text only from Liu et al., 2007
apoptotic process increased occurrence, abnormal AB + MO1-cdh4 standard conditions Fig. 10 from Liu et al., 2007
eye decreased size, abnormal AB + MO1-cdh4 standard conditions text only from Liu et al., 2007
retina structure, abnormal AB + MO1-cdh4 standard conditions text only from Liu et al., 2007
retinal ganglion cell decreased amount, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
lateral line nerve decreased size, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with image from Wilson et al., 2007
retina apoptotic, abnormal WT + MO1-cdh4 standard conditions Fig. 7 with image from Babb et al., 2005
photoreceptor cell differentiation disrupted, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with imageFig. 6 with image from Babb et al., 2005
eye decreased size, abnormal WT + MO1-cdh4 standard conditions text only from Wilson et al., 2007
Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Babb et al., 2005
lens decreased size, abnormal WT + MO1-cdh4 standard conditions Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 4 with image from Babb et al., 2005
posterior lateral line neuromast primordium migration decreased rate, abnormal WT + MO1-cdh4 standard conditions Fig. 8 with image from Wilson et al., 2007
retinal ganglion cell lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
amacrine cell differentiation disrupted, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
apoptotic process increased occurrence, abnormal WT + MO1-cdh4 standard conditions Fig. 7 with image from Babb et al., 2005
retinal ganglion cell layer sparse, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with imageFig. 5 with image from Babb et al., 2005
retinal ganglion cell layer compartment boundary rough, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
posterior lateral line nerve decreased length, abnormal WT + MO1-cdh4 standard conditions Fig. 6 with image from Wilson et al., 2007
retina lacks parts or has fewer parts of type photoreceptor cell, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retina hypoplastic, abnormal WT + MO1-cdh4 standard conditions Fig. 2 with image from Babb et al., 2005
hindbrain decreased size, abnormal WT + MO1-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
neuromast decreased amount, abnormal WT + MO1-cdh4 standard conditions Fig. 7 with imagetext only from Wilson et al., 2007
cranial nerve decreased size, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with image from Wilson et al., 2007
cranial nerve II decreased thickness, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
fourth ventricle increased size, abnormal WT + MO1-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
whole organism decreased length, abnormal WT + MO1-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
cranial nerve II truncated, abnormal WT + MO1-cdh4 standard conditions Fig. 9 with image from Babb et al., 2005
retina development in camera-type eye disrupted, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retina layer formation disrupted, abnormal WT + MO1-cdh4 standard conditions Fig. 1 with imageFig. 2 with imageFig. 6 with image from Babb et al., 2005
retinal ganglion cell layer disorganized, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
retinal ganglion cell axon guidance disrupted, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with imageFig. 9 with image from Babb et al., 2005
cell death increased occurrence, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Wilson et al., 2007
retina lacks parts or has fewer parts of type amacrine cell, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
retinal ganglion cell layer decreased thickness, abnormal WT + MO1-cdh4 standard conditions Fig. 5 with image from Babb et al., 2005
cranial nerve II sparse, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with imageFig. 9 with image from Babb et al., 2005
brain disorganized, abnormal WT + MO1-cdh4 standard conditions Fig. 1 with image from Babb et al., 2005
retinal ganglion cell neuron projection physical object quality, abnormal WT + MO1-cdh4 standard conditions Fig. 8 with imageFig. 9 with image from Babb et al., 2005
cranial nerve II fasciculation, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
optic tectum morphology, abnormal WT + MO1-cdh4 standard conditions Fig. 8 with imageFig. 9 with image from Babb et al., 2005
optic nerve development disrupted, abnormal WT + MO1-cdh4 standard conditions Fig. 4 with image from Babb et al., 2005
lens apoptotic, abnormal WT + MO1-cdh4 standard conditions Fig. 7 with image from Babb et al., 2005
apoptotic process increased occurrence, abnormal cdh2m117/m117 + MO1-cdh4 (AB) standard conditions Fig. 10 from Liu et al., 2007
eye shape, abnormal cdh2m117/m117 + MO1-cdh4 (AB) standard conditions Fig. 8 from Liu et al., 2007
Citations