Morpholino

MO2-dhrs9

ID
ZDB-MRPHLNO-050926-2
Name
MO2-dhrs9
Previous Names
  • MO2-rdh1l
  • rdh1l ATG-MO (1)
Target
Sequence
5' - TATATTGTCAGCTTTCAGAGTGGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dhrs9
No data available
Phenotype
Phenotype resulting from MO2-dhrs9
Phenotype Fish Figures
digestive tract development disrupted, abnormal WT + MO2-dhrs9 Fig. 3,  Fig. 4,  text only from Nadauld et al., 2005
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-dhrs9 Fig. 2 from Nadauld et al., 2005
eye decreased size, abnormal WT + MO2-dhrs9 Fig. 2 from Nadauld et al., 2005
heart looping arrested, abnormal AB + MO2-dhrs9 Fig. 1 from Wang et al., 2013
intestinal bulb hypoplastic, abnormal WT + MO2-dhrs9 Fig. 4,  text only from Nadauld et al., 2005
intestinal epithelium aplastic, abnormal WT + MO2-dhrs9 Fig. 4 from Nadauld et al., 2005
intestine lacks all parts of type intestinal villus, abnormal WT + MO2-dhrs9 Fig. 4 from Nadauld et al., 2005
intestine lacks all parts of type columnar/cuboidal epithelial cell, abnormal WT + MO2-dhrs9 Fig. 4 from Nadauld et al., 2005
intestine molecular quality, abnormal WT + MO2-dhrs9 Fig. 3 from Nadauld et al., 2005
intestine morphology, abnormal WT + MO2-dhrs9 Fig. 4 from Nadauld et al., 2005
mandibular arch skeleton absent, abnormal WT + MO2-dhrs9 Fig. 2 from Nadauld et al., 2005
pancreas development disrupted, abnormal WT + MO2-dhrs9 Fig. 3 from Nadauld et al., 2005
pectoral fin absent, abnormal WT + MO2-dhrs9 Fig. 2 from Nadauld et al., 2005
pectoral fin development disrupted, abnormal WT + MO2-dhrs9 Fig. 2 from Nadauld et al., 2005
pericardium edematous, abnormal WT + MO2-dhrs9 Fig. 2 from Nadauld et al., 2005
post-vent region curved ventral, abnormal AB + MO2-dhrs9 Fig. 1 from Wang et al., 2013
whole organism decreased size, abnormal AB + MO2-dhrs9 Fig. 1 from Wang et al., 2013
Phenotype of all Fish created by or utilizing MO2-dhrs9
Phenotype Fish Conditions Figures
whole organism decreased size, abnormal AB + MO2-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
heart looping arrested, abnormal AB + MO2-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
post-vent region curved ventral, abnormal AB + MO2-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
pectoral fin development disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
pericardium edematous, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
intestine molecular quality, abnormal WT + MO2-dhrs9 standard conditions Fig. 3 from Nadauld et al., 2005
intestine morphology, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
intestine lacks all parts of type columnar/cuboidal epithelial cell, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
mandibular arch skeleton absent, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
intestinal bulb hypoplastic, abnormal WT + MO2-dhrs9 standard conditions Fig. 4,  text only from Nadauld et al., 2005
pectoral fin absent, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
intestine lacks all parts of type intestinal villus, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
digestive tract development disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 3,  Fig. 4,  text only from Nadauld et al., 2005
pancreas development disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 3 from Nadauld et al., 2005
intestinal epithelium aplastic, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
eye decreased size, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
Citations