Morpholino
MO1-slit1a
- ID
- ZDB-MRPHLNO-050923-6
- Name
- MO1-slit1a
- Previous Names
- None
- Target
- Sequence
-
5' - GACAACATCCTCCTCTCGCAGGCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slit1a
No data available
Phenotype
Phenotype resulting from MO1-slit1a
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-slit1a
1 - 5 of 23 Show all
Citations
- Zecca, A., Dyballa, S., Voltes, A., Bradley, R., Pujades, C. (2015) The Order and Place of Neuronal Differentiation Establish the Topography of Sensory Projections and the Entry Points within the Hindbrain. The Journal of neuroscience : the official journal of the Society for Neuroscience. 35:7475-86
- Campbell, D.S., and Okamoto, H. (2013) Local caspase activation interacts with Slit-Robo signaling to restrict axonal arborization. The Journal of cell biology. 203(4):657-672
- Campbell, D.S., Stringham, S.A., Timm, A., Xiao, T., Law, M.Y., Baier, H., Nonet, M.L., and Chien, C.B. (2007) Slit1a inhibits retinal ganglion cell arborization and synaptogenesis via Robo2-dependent and -independent pathways. Neuron. 55(2):231-245
- Barresi, M.J., Hutson, L.D., Chien, C.B., and Karlstrom, R.O. (2005) Hedgehog regulated Slit expression determines commissure and glial cell position in the zebrafish forebrain. Development (Cambridge, England). 132(16):3643-3656
1 - 4 of 4
Show