Morpholino
MO1-fzd7a
- ID
- ZDB-MRPHLNO-050923-5
- Name
- MO1-fzd7a
- Previous Names
-
- fz7 MO (1)
- Target
- Sequence
-
5' - ATAAACCAACAAAAACCTCCTCGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the gene fzd7a.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fzd7a
No data available
Phenotype
Phenotype resulting from MO1-fzd7a
Phenotype | Fish | Figures |
---|---|---|
cardiac muscle tissue morphogenesis process quality, abnormal | WT + MO1-fzd7a |
Fig. 2
from Merks et al., 2018 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-fzd7a
1 - 5 of 5
Citations
- Merks, A.M., Swinarski, M., Meyer, A.M., Müller, N.V., Özcan, I., Donat, S., Burger, A., Gilbert, S., Mosimann, C., Abdelilah-Seyfried, S., Panáková, D. (2018) Planar cell polarity signalling coordinates heart tube remodelling through tissue-scale polarisation of actomyosin activity. Nature communications. 9:2161
- Nikaido, M., Law, E.W., and Kelsh, R.N. (2013) A Systematic Survey of Expression and Function of Zebrafish frizzled Genes. PLoS One. 8(1):e54833
- Fong, S.H., Emelyanov, A., Teh, C., and Korzh, V. (2005) Wnt signalling mediated by Tbx2b regulates cell migration during formation of the neural plate. Development (Cambridge, England). 132(16):3587-3596
1 - 3 of 3
Show