Morpholino
MO2-plcg1
- ID
- ZDB-MRPHLNO-050906-6
- Name
- MO2-plcg1
- Previous Names
- None
- Target
- Sequence
-
5' - AGAGCGTCCTCCTGACCTTGATGAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocker.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-plcg1
No data available
Phenotype
Phenotype resulting from MO2-plcg1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-plcg1
1 - 5 of 6 Show all
Citations
- Djenoune, L., Tomar, R., Dorison, A., Ghobrial, I., Schenk, H., Hegermann, J., Beverly-Staggs, L., Hidalgo-Gonzalez, A., Little, M.H., Drummond, I.A. (2021) Autonomous Calcium Signaling in Human and Zebrafish Podocytes Controls Kidney Filtration Barrier Morphogenesis. Journal of the American Society of Nephrology : JASN. 32(7):1697-1712
- Hsu, J.J., Vedula, V., Baek, K.I., Chen, C., Chen, J., Chou, M.I., Lam, J., Subhedar, S., Wang, J., Ding, Y., Chang, C.C., Lee, J., Demer, L.L., Tintut, Y., Marsden, A.L., Hsiai, T.K. (2019) Contractile and hemodynamic forces coordinate Notch1b-mediated outflow tract valve formation. JCI insight. 5(10):
- Rottbauer, W., Just, S., Wessels, G., Trano, N., Most, P., Katus, H.A., and Fishman, M.C. (2005) VEGF-PLC{gamma}1 pathway controls cardiac contractility in the embryonic heart. Genes & Development. 19(13):1624-1634
1 - 3 of 3
Show