Morpholino
MO1-invs
- ID
- ZDB-MRPHLNO-050727-1
- Name
- MO1-invs
- Previous Names
- Target
- Sequence
-
5' - GGACATAAGTACCTTCTCCATGCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a splice-blocking morpholino targeting the inversin gene.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-invs
No data available
Phenotype
Phenotype resulting from MO1-invs
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-invs
1 - 5 of 6 Show all
Citations
- Jaffe, K.M., Grimes, D.T., Schottenfeld-Roames, J., Werner, M.E., Ku, T.J., Kim, S.K., Pelliccia, J.L., Morante, N.F., Mitchell, B.J., Burdine, R.D. (2016) c21orf59/kurly Controls Both Cilia Motility and Polarization. Cell Reports. 14(8):1841-9
- Mahuzier, A., Gaudé, H.M., Grampa, V., Anselme, I., Silbermann, F., Leroux-Berger, M., Delacour, D., Ezan, J., Montcouquiol, M., Saunier, S., Schneider-Maunoury, S., and Vesque, C. (2012) Dishevelled stabilization by the ciliopathy protein Rpgrip1l is essential for planar cell polarity. The Journal of cell biology. 198(5):927-940
- Zhao, C., and Malicki, J. (2011) Nephrocystins and MKS proteins interact with IFT particle and facilitate transport of selected ciliary cargos. The EMBO journal. 30(13):2532-2544
- Simons, M., Gloy, J., Ganner, A., Bullerkotte, A., Bashkurov, M., Kronig, C., Schermer, B., Benzing, T., Cabello, O.A., Jenny, A., Mlodzik, M., Polok, B., Driever, W., Obara, T., and Walz, G. (2005) Inversin, the gene product mutated in nephronophthisis type II, functions as a molecular switch between Wnt signaling pathways. Nature Genetics. 37(5):537-543
1 - 4 of 4
Show