Morpholino
MO1-gdf6a
- ID
- ZDB-MRPHLNO-050708-1
- Name
- MO1-gdf6a
- Previous Names
- Target
- Sequence
-
5' - GCAATACAAACCTTTTCCCTTGTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking morpholino, resulting in production of gdf6a mRNA containing its lone intron. This allows for normal maternal gdf6a function, as gdf6a is required for patterning the early embryo, but inhibits zygotic gdf6a function prior to eye development. As high levels of necrosis are observed in gdf6a morphants, gdf6a morpholinos were co-injected with a p53 translation blocking morpholino. -- French et al. 2007, ZDB-PUB-070726-17
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gdf6a
No data available
Phenotype
Phenotype resulting from MO1-gdf6a
1 - 5 of 14 Show all
Phenotype of all Fish created by or utilizing MO1-gdf6a
1 - 5 of 16 Show all
Citations
- Hocking, J.C., Famulski, J.K., Yoon, K.H., Widen, S.A., Bernstein, C.S., Koch, S., Weiss, O., FORGE Canada Consortium, Agarwala, S., Inbal, A., Lehmann, O.J., Waskiewicz, A.J. (2018) Morphogenetic defects underlie Superior Coloboma, a newly identified closure disorder of the dorsal eye. PLoS Genetics. 14:e1007246
- Krispin, S., Stratman, A.N., Melick, C.H., Stan, R.V., Malinverno, M., Gleklen, J., Castranova, D., Dejana, E., Weinstein, B.M. (2017) Growth Differentiation Factor 6 Promotes Vascular Stability by Restraining Vascular Endothelial Growth Factor Signaling. Arteriosclerosis, Thrombosis, and Vascular Biology. 38(2):353-362
- Holly, V.L., Widen, S.A., Famulski, J.K., and Waskiewicz, A.J. (2014) Sfrp1a and Sfrp5 function as positive regulators of Wnt and BMP signaling during early retinal development. Developmental Biology. 388(2):192-204
- Reichert, S., Randall, R.A., and Hill C.S. (2013) A BMP regulatory network controls ectodermal cell fate decisions at the neural plate border. Development (Cambridge, England). 140(21):4435-4444
- Nguyen-Chi, M.E., Bryson-Richardson, R., Sonntag, C., Hall, T.E., Gibson, A., Sztal, T., Chua, W., Schilling, T.F., and Currie, P.D. (2012) Morphogenesis and Cell Fate Determination within the Adaxial Cell Equivalence Group of the Zebrafish Myotome. PLoS Genetics. 8(10):e1003014
- Erickson, T., French, C.R., and Waskiewicz, A.J. (2010) Meis1 specifies positional information in the retina and tectum to organize the zebrafish visual system. Neural Development. 5:22
- Ye, M., Berry-Wynne, K.M., Asai-Coakwell, M., Sundaresan, P., Footz, T., French, C.R., Abitbol, M., Fleisch, V.C., Corbett, N., Allison, W.T., Drummond, G., Walter, M.A., Underhill, T.M., Waskiewicz, A.J., and Lehmann, O.J. (2010) Mutation of the Bone Morphogenetic Protein GDF3 causes ocular and skeletal anomalies. Human molecular genetics. 19(2):287-298
- Asai-Coakwell, M., French, C.R., Ye, M., Garcha, K., Bigot, K., Perera, A.G., Staehling-Hampton, K., Mema, S.C., Chanda, B., Mushegian, A., Bamforth, S., Doschak, M.R., Li, G., Dobbs, M.B., Giampietro, P.F., Brooks, B.P., Vijayalakshmi, P., Sauvé, Y., Abitbol, M., Sundaresan, P., Heyningen, V.V., Pourquié, O., Underhill, T.M., Waskiewicz, A.J., and Lehmann, O.J. (2009) Incomplete penetrance and phenotypic variability characterize Gdf6-attributable oculo-skeletal phenotypes. Human molecular genetics. 18(6):1110-1121
- French, C.R., Erickson, T., French, D.V., Pilgrim, D.B., and Waskiewicz, A.J. (2009) Gdf6a is required for the initiation of dorsal-ventral retinal patterning and lens development. Developmental Biology. 333(1):37-47
- Asai-Coakwell, M., French, C.R., Berry, K.M., Ye, M., Koss, R., Somerville, M., Mueller, R., van Heyningen, V., Waskiewicz, A.J., and Lehmann, O.J. (2007) GDF6, a novel locus for a spectrum of ocular developmental anomalies. American journal of human genetics. 80(2):306-315
1 - 10 of 14
Show