Morpholino
MO1-ahr2
- ID
- ZDB-MRPHLNO-050604-1
- Name
- MO1-ahr2
- Previous Names
-
- MO2-ahr2
- Target
- Sequence
-
5' - TGTACCGATACCCGCCGACATGGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This morpholino is the same morpholino reported by Hill et al. 2004 and Prasch et al. 2003. The sequence published by Prasch et al. and Hill et al. contained typos. The sequence is correct as displayed here confirmed by author.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahr2
No data available
Phenotype
Phenotype resulting from MO1-ahr2
No data available
Phenotype of all Fish created by or utilizing MO1-ahr2
1 - 5 of 24 Show all
Citations
- Disner, G.R., Fernandes, T.A.M., Nishiyama-Jr, M.Y., Lima, C., Wincent, E., Lopes-Ferreira, M. (2024) TnP and AHR-CYP1A1 Signaling Crosstalk in an Injury-Induced Zebrafish Inflammation Model. Pharmaceuticals (Basel, Switzerland). 17(9):
- Chen, J., Zhang, M., Zou, H., Aniagu, S., Jiang, Y., Chen, T. (2023) PM2.5 induces mitochondrial dysfunction via AHR-mediated cyp1a1 overexpression during zebrafish heart development. Toxicology. 487:153466
- Cunha, V., Vogs, C., Le Bihanic, F., Dreij, K. (2020) Mixture effects of oxygenated PAHs and benzo[a]pyrene on cardiovascular development and function in zebrafish embryos. Environment International. 143:105913
- Garland, M.A., Geier, M.C., Bugel, S.M., Shankar, P., Dunham, C.L., Brown, J.M., Tilton, S.C., Tanguay, R.L. (2020) Aryl hydrocarbon receptor mediates larval zebrafish fin duplication following exposure to benzofluoranthenes. Toxicological sciences : an official journal of the Society of Toxicology. 176(1):46-64
- Nijoukubo, D., Adachi, H., Kitazawa, T., Teraoka, H. (2020) Blood vessels are primary targets for 2,3,7,8-tetrachlorodibenzo-p-dioxin in pre-cardiac edema formation in larval zebrafish. Chemosphere. 254:126808
- Dong, W., Wang, F., Fang, M., Wu, J., Wang, S., Li, M., Yang, J., Chernick, M., Hinton, D.E., Pei, D.S., Chen, H., Zheng, N., Mu, J., Xie, L., Dong, W. (2019) Use of biological detection methods to assess dioxin-like compounds in sediments of Bohai Bay, China. Ecotoxicology and environmental safety. 173:339-346
- Jin, H., Ji, C., Ren, F., Aniagu, S., Tong, J., Jiang, Y., Chen, T. (2019) AHR-mediated oxidative stress contributes to the cardiac developmental toxicity of trichloroethylene in zebrafish embryos. Journal of hazardous materials. 385:121521
- Ren, F., Ji, C., Huang, Y., Aniagu, S., Jiang, Y., Chen, T. (2019) AHR-mediated ROS production contributes to the cardiac developmental toxicity of PM2.5 in zebrafish embryos. The Science of the total environment. 719:135097
- Shankar, P., Geier, M.C., Truong, L., McClure, R.S., Pande, P., Waters, K.M., Tanguay, R.L. (2019) Coupling Genome-wide Transcriptomics and Developmental Toxicity Profiles in Zebrafish to Characterize Polycyclic Aromatic Hydrocarbon (PAH) Hazard. International Journal of Molecular Sciences. 20(10):
- Wu, P.Y., Chuang, P.Y., Chang, G.D., Chan, Y.Y., Tsai, T.C., Wang, B.J., Lin, K.H., Hsu, W.M., Liao, Y.F., Lee, H. (2019) Novel Endogenous Ligands of Aryl Hydrocarbon Receptor Mediate Neural Development and Differentiation of Neuroblastoma. ACS Chemical Neuroscience. 10(9):4031-4042
1 - 10 of 55
Show