Morpholino
MO1-myh11a
- ID
- ZDB-MRPHLNO-050602-1
- Name
- MO1-myh11a
- Previous Names
-
- MO1-myh11
- Target
- Sequence
-
5' - ATCATCGCTCAAGCCTTTCTTCGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myh11a
No data available
Phenotype
Phenotype resulting from MO1-myh11a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-myh11a
1 - 5 of 8 Show all
Citations
- Abrams, J., Einhorn, Z., Seiler, C., Zong, A.B., Sweeney, H.L., Pack, M. (2016) Graded effects of unregulated smooth muscle myosin on intestinal architecture, intestinal motility, and vascular function in zebrafish. Disease models & mechanisms. 9(5):529-40
- Davuluri, G., Seiler, C., Abrams, J., Soriano, A.J., and Pack, M. (2010) Differential effects of thin and thick filament disruption on zebrafish smooth muscle regulatory proteins. Neurogastroenterology and motility. 22(10):1100-e285
- Wallace, K.N., Dolan, A.C., Seiler, C., Smith, E.M., Yusuff, S., Chaille-Arnold, L., Judson, B., Sierk, R., Yengo, C., Sweeney, H.L., and Pack, M. (2005) Mutation of smooth muscle Myosin causes epithelial invasion and cystic expansion of the zebrafish intestine. Developmental Cell. 8(5):717-726
1 - 3 of 3
Show