Morpholino

MO1-boc

ID
ZDB-MRPHLNO-050517-1
Name
MO1-boc
Previous Names
None
Target
Sequence
5' - AATCCAATTCAACGTCCCAGACATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-boc
No data available
Phenotype
Phenotype resulting from MO1-boc
Phenotype Fish Figures
axon extension involved in axon guidance process quality, abnormal WT + MO1-boc Fig. 4 with image from Bergeron et al., 2011
axon guidance disrupted, abnormal WT + MO1-boc Fig. 5 from Connor et al., 2005
caudal commissure defasciculated, abnormal WT + MO1-boc Fig. 5 from Connor et al., 2005
caudal commissure axon mislocalised, abnormal WT + MO1-boc Fig. 5 from Connor et al., 2005
cranial nerve II misrouted, abnormal WT + MO1-boc Fig. 4 with image from Bergeron et al., 2011
dorsal/ventral axon guidance disrupted, abnormal WT + MO1-boc Fig. 5 from Connor et al., 2005
dorsoventral diencephalic tract morphology, abnormal WT + MO1-boc Fig. 5 from Connor et al., 2005
forebrain physical object quality, abnormal vu17Tg + MO1-boc Fig. 6 with image from Bergeron et al., 2011
forebrain development disrupted, abnormal WT + MO1-boc Fig. 5 from Connor et al., 2005
forebrain development process quality, abnormal vu17Tg + MO1-boc Fig. 6 with image from Bergeron et al., 2011
lateral floor plate physical object quality, abnormal vu17Tg + MO1-boc Fig. 6 with image from Bergeron et al., 2011
midbrain ventral region physical object quality, abnormal WT + MO1-boc Fig. 4 with image from Bergeron et al., 2011
post-vent region curved ventral, abnormal WT + MO1-boc Fig. 4 with image from Bergeron et al., 2011
regulation of smoothened signaling pathway process quality, abnormal vu17Tg + MO1-boc Fig. 6 with image from Bergeron et al., 2011
retinal ganglion cell axon guidance process quality, abnormal WT + MO1-boc Fig. 4 with image from Bergeron et al., 2011
spinal cord dorsal/ventral patterning process quality, abnormal vu17Tg + MO1-boc Fig. 6 with image from Bergeron et al., 2011
trunk curved ventral, abnormal WT + MO1-boc Fig. 4 with image from Bergeron et al., 2011
Phenotype of all Fish created by or utilizing MO1-boc
Phenotype Fish Conditions Figures
post-vent region curved ventral, abnormal WT + MO1-boc standard conditions Fig. 4 with image from Bergeron et al., 2011
dorsoventral diencephalic tract morphology, abnormal WT + MO1-boc standard conditions Fig. 5 from Connor et al., 2005
caudal commissure axon mislocalised, abnormal WT + MO1-boc standard conditions Fig. 5 from Connor et al., 2005
forebrain development disrupted, abnormal WT + MO1-boc standard conditions Fig. 5 from Connor et al., 2005
trunk curved ventral, abnormal WT + MO1-boc standard conditions Fig. 4 with image from Bergeron et al., 2011
axon guidance disrupted, abnormal WT + MO1-boc standard conditions Fig. 5 from Connor et al., 2005
dorsal/ventral axon guidance disrupted, abnormal WT + MO1-boc standard conditions Fig. 5 from Connor et al., 2005
caudal commissure defasciculated, abnormal WT + MO1-boc standard conditions Fig. 5 from Connor et al., 2005
axon extension involved in axon guidance process quality, abnormal WT + MO1-boc standard conditions Fig. 4 with image from Bergeron et al., 2011
cranial nerve II misrouted, abnormal WT + MO1-boc standard conditions Fig. 4 with image from Bergeron et al., 2011
retinal ganglion cell axon guidance process quality, abnormal WT + MO1-boc standard conditions Fig. 4 with image from Bergeron et al., 2011
midbrain ventral region physical object quality, abnormal WT + MO1-boc standard conditions Fig. 4 with image from Bergeron et al., 2011
regulation of smoothened signaling pathway process quality, abnormal vu17Tg + MO1-boc standard conditions Fig. 6 with image from Bergeron et al., 2011
spinal cord dorsal/ventral patterning process quality, abnormal vu17Tg + MO1-boc standard conditions Fig. 6 with image from Bergeron et al., 2011
forebrain physical object quality, abnormal vu17Tg + MO1-boc standard conditions Fig. 6 with image from Bergeron et al., 2011
lateral floor plate physical object quality, abnormal vu17Tg + MO1-boc standard conditions Fig. 6 with image from Bergeron et al., 2011
forebrain development process quality, abnormal vu17Tg + MO1-boc standard conditions Fig. 6 with image from Bergeron et al., 2011
Citations