Morpholino
MO1-sema3ab
- ID
- ZDB-MRPHLNO-050513-4
- Name
- MO1-sema3ab
- Previous Names
- None
- Target
- Sequence
-
5' - GTACAATCCACCACAAGTAGTCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocker.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sema3ab
No data available
Phenotype
Phenotype resulting from MO1-sema3ab
No data available
Phenotype of all Fish created by or utilizing MO1-sema3ab
No data available
Citations
- Jiang, Q., Arnold, S., Heanue, T., Kilambi, K.P., Doan, B., Kapoor, A., Ling, A.Y., Sosa, M.X., Guy, M., Jiang, Q., Burzynski, G., West, K., Bessling, S., Griseri, P., Amiel, J., Fernandez, R.M., Verheij, J.B., Hofstra, R.M., Borrego, S., Lyonnet, S., Ceccherini, I., Gray, J.J., Pachnis, V., McCallion, A.S., Chakravarti, A. (2015) Functional Loss of Semaphorin 3C and/or Semaphorin 3D and Their Epistatic Interaction with Ret Are Critical to Hirschsprung Disease Liability. American journal of human genetics. 96:581-596
- Feldner, J., Reimer, M.M., Schweitzer, J., Wendik, B., Meyer, D., Becker, T., and Becker, C.G. (2007) PlexinA3 restricts spinal exit points and branching of trunk motor nerves in embryonic zebrafish. The Journal of neuroscience : the official journal of the Society for Neuroscience. 27(18):4978-4983
- Kuan, Y.S., Yu, H.H., Moens, C.B., and Halpern, M.E. (2007) Neuropilin asymmetry mediates a left-right difference in habenular connectivity. Development (Cambridge, England). 134(5):857-865
- Tanaka, H., Maeda, R., Shoji, W., Wada, H., Masai, I., Shiraki, T., Kobayashi, M., Nakayama, R., and Okamoto, H. (2007) Novel mutations affecting axon guidance in zebrafish and a role for plexin signalling in the guidance of trigeminal and facial nerve axons. Development (Cambridge, England). 134(18):3259-3269
- Feldner, J., Becker, T., Goishi, K., Schweitzer, J., Lee, P., Schachner, M., Klagsbrun, M., and Becker, C.G. (2005) Neuropilin-1a is involved in trunk motor axon outgrowth in embryonic zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 234(3):535-549
- Yu, H.H., and Moens, C.B. (2005) Semaphorin signaling guides cranial neural crest cell migration in zebrafish. Developmental Biology. 280(2):373-385
1 - 6 of 6
Show