Morpholino
MO1-wnt3a
- ID
- ZDB-MRPHLNO-050509-2
- Name
- MO1-wnt3a
- Previous Names
-
- MO1-wnt3l
- Target
- Sequence
-
5' - TGTTTTTACCGAACGTCCAGCTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt3a
No data available
Phenotype
Phenotype resulting from MO1-wnt3a
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO1-wnt3a
1 - 5 of 50 Show all
Citations
- Neiswender, H., Navarre, S., Kozlowski, D.J., LeMosy, E.K. (2017) Early Craniofacial Defects in Zebrafish That Have Reduced Function of a Wnt-Interacting Extracellular Matrix Protein, Tinagl1. The Cleft palate-craniofacial journal : official publication of the American Cleft Palate-Craniofacial Association. 54(4):381-390
- Lin, X., and Xu, X. (2009) Distinct functions of Wnt/{beta}-catenin signaling in KV development and cardiac asymmetry. Development (Cambridge, England). 136(2):207-217
- Sun, X., Zhang, R., Lin, X., and Xu, X. (2008) Wnt3a Regulates the Development of Cardiac Neural Crest Cells by Modulating Expression of Cysteine-Rich Intestinal Protein 2 in Rhombomere 6. Circulation research. 102(7):831-839
- Shimizu, T., Bae, Y.K., and Hibi, M. (2006) Cdx-Hox code controls competence for responding to Fgfs and retinoic acid in zebrafish neural tissue. Development (Cambridge, England). 133(23):4709-4719
- Shimizu, T., Bae, Y.K., Muraoka, O., and Hibi, M. (2005) Interaction of Wnt and caudal-related genes in zebrafish posterior body formation. Developmental Biology. 279(1):125-141
- Thorpe, C.J., Weidinger, G., and Moon, R.T. (2005) Wnt/β-catenin regulation of the Sp1-related transcription factor sp5l promotes tail development in zebrafish. Development (Cambridge, England). 132(8):1763-1772
1 - 6 of 6
Show