Morpholino

MO1-wnt3a

ID
ZDB-MRPHLNO-050509-2
Name
MO1-wnt3a
Previous Names
  • MO1-wnt3l
Target
Sequence
5' - TGTTTTTACCGAACGTCCAGCTTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt3a
No data available
Phenotype
Phenotype resulting from MO1-wnt3a
Phenotype Fish Figures
aortic arch morphology, abnormal WT + MO1-wnt3a Fig. 5 from Sun et al., 2008
ceratobranchial cartilage agenesis, abnormal TU + MO1-wnt3a Fig. 4,  Table 1 from Neiswender et al., 2017
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-wnt3a Fig. 1 with image,  Fig. 3 with image from Lin et al., 2009
embryonic viscerocranium morphogenesis disrupted, abnormal TU + MO1-wnt3a Fig. 4 from Neiswender et al., 2017
Fig. 5 from Sun et al., 2008
ethmoid cartilage aplastic, abnormal TU + MO1-wnt3a Fig. 4,  Table 1 from Neiswender et al., 2017
heart decreased functionality, abnormal WT + MO1-wnt3a Fig. 6 from Sun et al., 2008
heart contraction decreased rate, abnormal WT + MO1-wnt3a Fig. 6 from Sun et al., 2008
heart looping disrupted, abnormal TL + MO1-wnt3a Fig. 1 with image from Lin et al., 2009
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-wnt3a Fig. 2 with image from Lin et al., 2009
mandibular arch skeleton aplastic, abnormal WT + MO1-wnt3a Fig. 5 from Sun et al., 2008
neurocranial trabecula aplastic, abnormal TU + MO1-wnt3a Fig. 4,  Table 1 from Neiswender et al., 2017
notochord truncated, abnormal AB + MO1-wnt3a Fig. 4 with image,  Fig. 6 with image from Thorpe et al., 2005
pericardium edematous, abnormal WT + MO1-wnt3a Fig. 6 from Sun et al., 2008
pharyngeal arch 3-7 morphology, abnormal WT + MO1-wnt3a Fig. 5 from Sun et al., 2008
pharyngeal arch 3-7 skeleton decreased size, abnormal WT + MO1-wnt3a Fig. 5 from Sun et al., 2008
pharyngeal system development disrupted, abnormal WT + MO1-wnt3a Fig. 5 from Sun et al., 2008
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt3a Fig. 1 with image from Thorpe et al., 2005
post-vent region curved ventral, abnormal WT + MO1-wnt3a Fig. Table 1 from Shimizu et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt3a Fig. 1 with image,  Fig. 6 with image from Thorpe et al., 2005
somite decreased amount, abnormal AB + MO1-wnt3a Fig. 4 with image from Thorpe et al., 2005
tail bud decreased length, abnormal AB + MO1-wnt3a Fig. 1 with image from Thorpe et al., 2005
tail bud morphology, abnormal AB + MO1-wnt3a Fig. 4 with image from Thorpe et al., 2005
whole organism decreased length, abnormal AB + MO1-wnt3a Fig. 1 with image from Thorpe et al., 2005
Phenotype of all Fish created by or utilizing MO1-wnt3a
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal AB + MO1-wnt3a standard conditions Fig. 1 with image from Thorpe et al., 2005
somite decreased amount, abnormal AB + MO1-wnt3a standard conditions Fig. 4 with image from Thorpe et al., 2005
tail bud decreased length, abnormal AB + MO1-wnt3a standard conditions Fig. 1 with image from Thorpe et al., 2005
tail bud morphology, abnormal AB + MO1-wnt3a standard conditions Fig. 4 with image from Thorpe et al., 2005
notochord truncated, abnormal AB + MO1-wnt3a standard conditions Fig. 4 with image,  Fig. 6 with image from Thorpe et al., 2005
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt3a standard conditions Fig. 1 with image from Thorpe et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt3a standard conditions Fig. 1 with image,  Fig. 6 with image from Thorpe et al., 2005
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-wnt3a standard conditions Fig. 1 with image,  Fig. 3 with image from Lin et al., 2009
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-wnt3a standard conditions Fig. 2 with image from Lin et al., 2009
heart looping disrupted, abnormal TL + MO1-wnt3a standard conditions Fig. 1 with image from Lin et al., 2009
neurocranial trabecula aplastic, abnormal TU + MO1-wnt3a standard conditions Fig. 4,  Table 1 from Neiswender et al., 2017
ethmoid cartilage aplastic, abnormal TU + MO1-wnt3a standard conditions Fig. 4,  Table 1 from Neiswender et al., 2017
ceratobranchial cartilage agenesis, abnormal TU + MO1-wnt3a standard conditions Fig. 4,  Table 1 from Neiswender et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal TU + MO1-wnt3a standard conditions Fig. 4 from Neiswender et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO1-wnt3a standard conditions Fig. 5 from Sun et al., 2008
aortic arch morphology, abnormal WT + MO1-wnt3a standard conditions Fig. 5 from Sun et al., 2008
heart decreased functionality, abnormal WT + MO1-wnt3a standard conditions Fig. 6 from Sun et al., 2008
mandibular arch skeleton aplastic, abnormal WT + MO1-wnt3a standard conditions Fig. 5 from Sun et al., 2008
pharyngeal arch 3-7 morphology, abnormal WT + MO1-wnt3a standard conditions Fig. 5 from Sun et al., 2008
heart contraction decreased rate, abnormal WT + MO1-wnt3a standard conditions Fig. 6 from Sun et al., 2008
post-vent region curved ventral, abnormal WT + MO1-wnt3a standard conditions Fig. Table 1 from Shimizu et al., 2005
pharyngeal arch 3-7 skeleton decreased size, abnormal WT + MO1-wnt3a standard conditions Fig. 5 from Sun et al., 2008
pharyngeal system development disrupted, abnormal WT + MO1-wnt3a standard conditions Fig. 5 from Sun et al., 2008
pericardium edematous, abnormal WT + MO1-wnt3a standard conditions Fig. 6 from Sun et al., 2008
tail bud decreased length, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
somite decreased amount, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
notochord truncated, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
central canal dilated, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
tail bud bent, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
whole organism decreased length, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 1 with image from Thorpe et al., 2005
tail bud morphology, abnormal AB + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. 4 with image from Thorpe et al., 2005
notochord truncated, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
post-anal tail morphogenesis disrupted, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
somite decreased amount, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
post-vent region decreased length, abnormal AB + MO1-wnt3a + MO2-sp5l standard conditions Fig. 6 with image from Thorpe et al., 2005
Kupffer's vesicle cilium decreased length, abnormal TL + MO1-wnt3a + MO1-wnt8a standard conditions Fig. 2 with image from Lin et al., 2009
heart looping disrupted, abnormal TL + MO1-wnt3a + MO1-wnt8a standard conditions Fig. 1 with image from Lin et al., 2009
embryonic heart tube left/right pattern formation disrupted, abnormal TL + MO1-wnt3a + MO1-wnt8a standard conditions Fig. 1 with image from Lin et al., 2009
neurocranial trabecula aplastic, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4,  Table 1 from Neiswender et al., 2017
pharyngeal arch cartilage aplastic, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4 from Neiswender et al., 2017
ethmoid cartilage aplastic, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4,  Table 1 from Neiswender et al., 2017
ceratobranchial cartilage agenesis, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Table 1 from Neiswender et al., 2017
embryonic viscerocranium morphogenesis disrupted, abnormal TU + MO1-wnt3a + MO2-tinagl1 standard conditions Fig. 4 from Neiswender et al., 2017
post-vent region has fewer parts of type somite, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region truncated, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
head increased size, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region decreased length, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region kinked, abnormal WT + MO1-wnt3a + MO1-wnt8a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
Citations