Morpholino
MO2-prdm1a
- ID
- ZDB-MRPHLNO-050429-1
- Name
- MO2-prdm1a
- Previous Names
-
- E2I2 prdm1-MO (1)
- MO2-prdm1
- Target
- Sequence
-
5' - TGGTGTCATACCTCTTTGGAGTCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
exon 2 - intron 2 splice-blocking MO
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prdm1a
No data available
Phenotype
Phenotype resulting from MO2-prdm1a
1 - 5 of 15 Show all
Phenotype of all Fish created by or utilizing MO2-prdm1a
1 - 5 of 37 Show all
Citations
- Kamei, H., Yoneyama, Y., Hakuno, F., Sawada, R., Shimizu, T., Duan, C., Takahashi, S.I. (2018) Catch-up growth in zebrafish embryo requires neural crest cells sustained by Irs1-signaling. Endocrinology. 159(4):1547-1560
- LaMonica, K., Ding, H.L., Artinger, K.B. (2015) prdm1a functions upstream of itga5 in zebrafish craniofacial development. Genesis (New York, N.Y. : 2000). 53(3-4):270-7
- Ding, H.L., Clouthier, D.E., and Artinger, K.B. (2013) Redundant roles of PRDM family members in zebrafish craniofacial development. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(1):67-79
- Powell, D.R., Hernandez-Lagunas, L., Lamonica, K., and Artinger, K.B. (2013) Prdm1a directly activates foxd3 and tfap2a during zebrafish neural crest specification. Development (Cambridge, England). 140(16):3445-3455
- Liu, C., Ma, W., Su, W., and Zhang, J. (2012) Prdm14 acts upstream of islet2 transcription to regulate axon growth of primary motoneurons in zebrafish. Development (Cambridge, England). 139(24):4591-4600
- Wang, X., Ono, Y., Tan, S.C., Chai, R.J., Parkin, C., and Ingham, P.W. (2011) Prdm1a and miR-499 act sequentially to restrict Sox6 activity to the fast-twitch muscle lineage in the zebrafish embryo. Development (Cambridge, England). 138(20):4399-404
- Rossi, C.C., Kaji, T., and Artinger, K.B. (2009) Transcriptional control of Rohon-Beard sensory neuron development at the neural plate border. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(4):931-943
- Liew, H.P., Choksi, S.P., Wong, K.N., and Roy, S. (2008) Specification of vertebrate slow-twitch muscle fiber fate by the transcriptional regulator Blimp1. Developmental Biology. 324(2):226-235
- von Hofsten, J., Elworthy, S., Gilchrist, M.J., Smith, J.C., Wardle, F.C., and Ingham, P.W. (2008) Prdm1- and Sox6-mediated transcriptional repression specifies muscle fibre type in the zebrafish embryo. EMBO reports. 9(7):683-689
- Lee, B.C., and Roy, S. (2006) Blimp-1 is an essential component of the genetic program controlling development of the pectoral limb bud. Developmental Biology. 300(2):623-634
1 - 10 of 12
Show