Morpholino
MO1-stk36
- ID
- ZDB-MRPHLNO-050308-9
- Name
- MO1-stk36
- Previous Names
-
- fu MO1 (1)
- Target
- Sequence
-
5' - TGGTACTGATCCATCTCCAGCGACG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting stk36.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-stk36
No data available
Phenotype
Phenotype resulting from MO1-stk36
1 - 5 of 29 Show all
Phenotype of all Fish created by or utilizing MO1-stk36
1 - 5 of 34 Show all
Citations
- Xia, L., Jia, S., Huang, S., Wang, H., Zhu, Y., Mu, Y., Kan, L., Zheng, W., Wu, D., Li, X., Sun, Q., Meng, A., and Chen, D. (2010) The Fused/Smurf Complex Controls the Fate of Drosophila Germline Stem Cells by Generating a Gradient BMP Response. Cell. 143(6):978-990
- Wilson, C.W., Nguyen, C.T., Chen, M.H., Yang, J.H., Gacayan, R., Huang, J., Chen, J.N., and Chuang, P.T. (2009) Fused has evolved divergent roles in vertebrate Hedgehog signalling and motile ciliogenesis. Nature. 459(7243):98-102
- Wolff, C., Roy, S., and Ingham, P.W. (2003) Multiple muscle cell identities induced by distinct levels and timing of hedgehog activity in the zebrafish embryo. Current biology : CB. 13(14):1169-1181
1 - 3 of 3
Show